Question

TATA-Pribnow box: Motifs TATAAA or TATAAT of six nucleotides, known as TATA boxes, are an essential...

TATA-Pribnow box: Motifs TATAAA or TATAAT of six nucleotides, known as TATA boxes, are an essential part of a promoter site on DNA for transcription to occur. Write a Python program that finds all the TATA boxes in a DNA sequence and reports their types and locations. If there is no such a box, your program should report that as well. Test your program on several DNA sequences with none, and with several TATA boxes of both types. Please use input for DNA sequence and use while and if-else statements.

Homework Answers

Answer #1
  • Below is the detailed explanation and implementation of the above problem in PYTHON with code and multiple output shown.
  • Please read comments for better understanding.
  • CODE:

#function which prints occurence of TATA boxes of both types if found as list of indices(starting index) where found
def find(DNA):
#list of TATA boxes
l=['TATAAA', 'TATAAT']
  
#create empty list for both tata boxes to store indices of occurence
ans=[[], []]
#for all kind of TATA boxes
#traverse the DNA sequence
i=0
while i<len(l):
j=0
#traverse the sequence
while j<(len(DNA)-5):
#sequence starting from i of length 6
sub=DNA[j:j+6]
if sub==l[i]:
ans[i].append(j)
j+=1

i+=1
#if not found any
if(len(ans[0])==0 and len(ans[1])==0):
print("No tata boxes found in the DNA sequence!")
#otherwise
else:
k=0
while k<len(l):
if len(ans[k])>0:
print(l[k]+" found at : ",*ans[k])
k+=1
#return
return

#test DNA sequence
DNA=input()
find(DNA)

  • INPUT/OUTPUT:
  1. TACAAAAG
    No tata boxes found in the DNA sequence!
  2. TATAATTATATA
    TATAAT found at :  0
  3. TATAAAATATAAAGTATAAT
    TATAAA found at :  0 7
    TATAAT found at :  14
  • For better understanding and clarity below are the attached screenshots of the code and input/outputs.

CODE

INPUT/OUTPUT

So if you have any dobt rgearding this explanation please feel free to ask it in the comment section below and if it is helpful then please upvote this solution, THANK YOU.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Restriction enzymes, also known as restriction endonucleases, are enzymes that cut a DNA molecule at a...
Restriction enzymes, also known as restriction endonucleases, are enzymes that cut a DNA molecule at a particular place. They are essential tools for recombinant DNA technology. The enzyme "scans" a DNA molecule, looking for a particular sequence, usually of four to six nucleotides. Once it finds this recognition sequence, it stops and cuts the strands. This is known as enzyme digestion. On double stranded DNA the recognition sequence is on both strands, but runs in opposite directions. This allows the...
The picture shown below shows variation among three individuals with respect to 4 nucleotides - AGAT....
The picture shown below shows variation among three individuals with respect to 4 nucleotides - AGAT. What do you think what type of variation is this? AGAT different repeat numbers in different individuals .png Minisatellite Single nucleotide polymorphism Short Tandem Repeats Which of the following statements is TRUE about DNA matching? Typical difference between the genomes of human beings and Chimpanzees is estimated to be 25 % Typical difference between the genomes of human beings and Drosophila is   estimated to...
Looking at quid pro quo sexual harassment and hostile work environment sexual harassment laws, if Paola...
Looking at quid pro quo sexual harassment and hostile work environment sexual harassment laws, if Paola brings a sexual harassment lawsuit against VS, who will win? Paola Innocente lives with her husband and son in South City. She is 30 years old and an Italian immigrant. She worked in the fashion industry as a model in New York City until she met her husband and they moved to his hometown, St. Louis, in 2011. Since then she held many part-time...
Review the Robatelli's Pizzeria Case Study. Develop another internal controls system, but this time, in the...
Review the Robatelli's Pizzeria Case Study. Develop another internal controls system, but this time, in the purchases and fixed assets business areas. Prepare a 12- to 16-slide presentation describing the purchases and fixed assets business areas. Be sure to incorporate speaker notes as well as appropriate visuals, graphics, fonts, etc. Include any associated risk in these areas. Describe specific internal controls that include authorization of transactions, segregation of duties, adequate records and documentation, security of assets, and independent checks and...
Mattel Responds to Ethical Challenges Business Ethics This case was written by Debbie Thorne, John Fraedrich,...
Mattel Responds to Ethical Challenges Business Ethics This case was written by Debbie Thorne, John Fraedrich, O. C. Ferrell, and Jennifer Jackson, with the editorial assistance of Jennifer Sawayda. This case was developed for classroom discussion rather than to illustrate either effective or ineffective handling of an administrative, ethical, or legal discussion by management. All sources used for this case were obtained through publicly available material. Mattel, Inc. is a world leader in the design, manufacture, and marketing of family...
Please read the article and answear about questions. Determining the Value of the Business After you...
Please read the article and answear about questions. Determining the Value of the Business After you have completed a thorough and exacting investigation, you need to analyze all the infor- mation you have gathered. This is the time to consult with your business, financial, and legal advis- ers to arrive at an estimate of the value of the business. Outside advisers are impartial and are more likely to see the bad things about the business than are you. You should...
What tools could AA leaders have used to increase their awareness of internal and external issues?...
What tools could AA leaders have used to increase their awareness of internal and external issues? ???ALASKA AIRLINES: NAVIGATING CHANGE In the autumn of 2007, Alaska Airlines executives adjourned at the end of a long and stressful day in the midst of a multi-day strategic planning session. Most headed outside to relax, unwind and enjoy a bonfire on the shore of Semiahmoo Spit, outside the meeting venue in Blaine, a seaport town in northwest Washington state. Meanwhile, several members of...