Question

Name 3 post transcriptional modifications of eukaryotic mRNA and briefly explain the purpose of each

Name 3 post transcriptional modifications of eukaryotic mRNA and briefly explain the purpose of each

Homework Answers

Answer #1

The post transcriptional modifications and their purposes are :

1 . Splicing :

Here the introns are removed from the mRNA , and the exons are joined in a specific order. The process removes the non functional portions of primary transcripts.

2. Capping :

Methyl guanosine triphosphate is added to the 5'-end of the hn RNA molecule. This provides stability to the molecule.

3. Tailing :

200-300 residues of adenylate are added to the 3'-end of the molecule . The purpose is to prevent the molecule from enzymatic degradation in the cytoplasm.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
For each mechanism of eukaryotic gene regulation, specify whether it is pre-transcriptional or post transcriptional Methylation...
For each mechanism of eukaryotic gene regulation, specify whether it is pre-transcriptional or post transcriptional Methylation of CpG islands in the promoter histone acetylation RNA interference
. What are post translational modifications? What purpose do they serve? Give at least 3 examples.
. What are post translational modifications? What purpose do they serve? Give at least 3 examples.
1. Post transcriptional modification of RNA by addition of nucleotides that are not encoded in the...
1. Post transcriptional modification of RNA by addition of nucleotides that are not encoded in the DNA sequence occurs for some RNA products. Which of the following is correct pairing of RNA product and modification? A. tRNA - CCA added to 3' end B. mRNA - CCA added to 3' end C. rRNA - poly A added to 3' end mRNA - 7meG added to 3' end 2. Predict the mRNA sequence that is encoded by the DNA sequence shown...
Describe how RNAi works, and explain how RNAi is involved in post transcriptional regulation.
Describe how RNAi works, and explain how RNAi is involved in post transcriptional regulation.
Briefly define autocorrelation and why it poses a problem in timeseries forecasting? Briefly explain the purpose...
Briefly define autocorrelation and why it poses a problem in timeseries forecasting? Briefly explain the purpose of interval estimation in forecasting and how you would interpret a 95% prediction interval
Briefly explain why all iatrogenic infections are so-called Healthcare Associated Infections (HAIs), and name 3 that...
Briefly explain why all iatrogenic infections are so-called Healthcare Associated Infections (HAIs), and name 3 that are caused by patient’s natural microbiota and 2 that are introduced from the environment (transients). Indicate the route of transmission and measures to prevent each of them.
Name four most important factors that contribute to enzyme catalysis and briefly explain the effects of...
Name four most important factors that contribute to enzyme catalysis and briefly explain the effects of each.
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).
The somatosensory system is actually 3 separate systems. Name them and briefly describe the function of...
The somatosensory system is actually 3 separate systems. Name them and briefly describe the function of each
Name the substance that aids in establishing neonatla circulations AND briefly explain its function
Name the substance that aids in establishing neonatla circulations AND briefly explain its function