Question

give an example of a structure intergenic sequence and its function in DNA

give an example of a structure intergenic sequence and its function in DNA
Science   Chemistry   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Intergenic sequnces contributes to the non-coding DNA. It is usually found in the location between the genes which is different from the intragenic sequences in the sense that they are found within the genes,. Thus intergenic sequence includes any of the region in between gene-coding DNA including untranslated regions, 5' and 3' regions(the region which houses 3' and 5' end of the transcription unit), introns, non-functional pseudogenes , non-functional repetitive sequences.

This DNA may or may not encode regulatory functions but the other functions are still unknown. This is also known as the 'dark region' of the DNA.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Give one example of how the structure and function of a cell are related. Give one...
Give one example of how the structure and function of a cell are related. Give one example of how the structure and function of a tissue are related. Give one example that shows how two organs of the muscular system work together. Give one example that shows how two organs of the skeletal system work together. What is the literal meaning of osteoporosis? Which stratum must receive a constant supply of oxygen: basale or corneum? Why?
The relative hybrid duplex structure of DNA and RNA is greatly influenced by primary sequence composition....
The relative hybrid duplex structure of DNA and RNA is greatly influenced by primary sequence composition. The primary sequence dictates duplex structure and stability, giving DNA a B-type helix, RNA an A-type helix and DNA:RNA a mixed A:B type helix. Based on the structural and thermodynamic study of DNA and RNA duplexes, rationalize which type of hybrid duplexes form the most stable structures and describe experimental methods that can be used to characterize i. duplex stability and ii. duplex structure
Explain the relationship between sequence, structure, and function in terms of amino acid sequence.
Explain the relationship between sequence, structure, and function in terms of amino acid sequence.
Mutations can be classi?ed by their effect on the DNA sequence OR the encoded protein. a....
Mutations can be classi?ed by their effect on the DNA sequence OR the encoded protein. a. How do mutations in the DNA alter protein structure? b. How do mutations in proteins alter their function? c. Why are some mutations less deleterious than others?
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
5' AGTTGTATAGAAAACTGCGAA 3' What DNA sequence (give as 5' to 3') would be formed by replicating...
5' AGTTGTATAGAAAACTGCGAA 3' What DNA sequence (give as 5' to 3') would be formed by replicating the sequence shown above? What RNA sequence (give as 5' to 3') would be formed by transcribing the sequence formed in part 1? What protein sequence (give as N to C terminus) would be formed by translating the sequence formed in part 2?
The famous -10 and -35 DNA sigma factor binding motifs function as? A. DNA sequence landmarks...
The famous -10 and -35 DNA sigma factor binding motifs function as? A. DNA sequence landmarks that ensure proper sigma favor binding to promoter regions, and as a result bring along RNA polymerase to park at a position enabling transcription at position +1. B. the -10 motif binds inducers (e.g., Cap/cAMP) and -35 motif binds a repressor (e.g., LacI). C. DNA sequence landmarks that interact directly with RNA polymerase placing the transcription initiation at position +1. D. transcription repressors, preventing...
How to co-relate DNA sequence to protein sequence? How to co-relate DNA sequence to protein sequence...
How to co-relate DNA sequence to protein sequence? How to co-relate DNA sequence to protein sequence of PTC receptor (or TAS2R38 gene)?
1. Can a sequence attain its limit; that is, can the limit of a sequence be...
1. Can a sequence attain its limit; that is, can the limit of a sequence be one of the terms of the sequence? If so, give an example. If not, explain. 2. If a sequence never attains its limit; could its terms consist of a finite number of distinct values? If so, give an example. If not, explain.
DNA encodes proteins by reading the sequence in ordered triplets. For example, the three ordered triplets...
DNA encodes proteins by reading the sequence in ordered triplets. For example, the three ordered triplets in the ACCAGGTTA sequence are ACC, AGG, and TTA. That is, a different triplet can encode a different amino acid. How many different amino acids can be coded for each ordered triplet?
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT