Question

The ribonucleotide polymer (5')GUCCAUUCAG(3') could only form a double-stranded structure with: Group of answer choices (5')CAGGUAAGUC(3')....

The ribonucleotide polymer (5')GUCCAUUCAG(3') could only form a double-stranded structure with:

Group of answer choices

(5')CAGGUAAGUC(3').

(5')CUGAAUGGAC(3').

(5')GACUUACCUG(3').

(5')GUCCAUUCAG(3').

(5')GCCTAGTTUG(3').

2.

Which DNA sequence is palindromic?

Group of answer choices

5´GGCTGCGCAATC3´

5´GACTCGGCAATC3´

5´GGCTCGGCAACC3´

5´GGCTCGACAATC3´

5´GGCTTGCAAGCC3´

Science   Chemistry   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
What does all double-stranded DNA have in common? Group of answer choices melting point number of...
What does all double-stranded DNA have in common? Group of answer choices melting point number of hydrogen bonds sugar-phosphate backbone nitrogen-containing base sequence weight
Which of the following statements about the structure of double-stranded DNA is FALSE? 1. DNA is...
Which of the following statements about the structure of double-stranded DNA is FALSE? 1. DNA is stabilized primarily by H-bonding between the bases. 2. Only non-covalent forces stabilize the helix so that the DNA can unwind during replication and transcription. 3. The phosphodiester backbone interacts with Mg2+ in the cell. 4. Some groups of the bases are exposed in the grooves of double-stranded DNA.
Which of the following could cause double strand breaks in the DNA? Group of answer choices...
Which of the following could cause double strand breaks in the DNA? Group of answer choices continuous exposure to long-wavelength radiation continuous exposure to ethidium bromide, an intercalating agent continuous exposure to X-ray radiation continuous exposure to alkylating agents
Fragment of double-stranded DNA: 5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3' Which primer could amplify the whole fragment of the...
Fragment of double-stranded DNA: 5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3' Which primer could amplify the whole fragment of the following? a) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ b) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ c) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ d) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ e) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
Which of the following single-stranded nucleic acid strands could form a hairpin structure in solution? a....
Which of the following single-stranded nucleic acid strands could form a hairpin structure in solution? a. 5’-TTTGCGATACTCATCGCATT-3’ b. 5’-TTTGCGATACTCACGCTATT-3’ c. 5’-TTTGCGATACTCTGCGATTT-3’ d. All the answers are correct e. All the answers are incorrect Please explain answer.
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will...
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will be amplified by PCR using short primers:      5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3'      Primers that could be used to amplify this entire DNA fragment are: A) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ B) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ C) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ D) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ E) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
Listed below are two different single strands of DNA. Which of these, in their double-stranded form...
Listed below are two different single strands of DNA. Which of these, in their double-stranded form would you expect to be cleaved by a restriction enzyme? a) CTCGCCAATTGACTCGTC b) ACTCCACTCCCGACTCCA For each answer explain why or why not, using the bases of the specific example.
DNA can be distinguished from its “cousin” RNA because A. DNA is always single stranded B....
DNA can be distinguished from its “cousin” RNA because A. DNA is always single stranded B. DNA is always double stranded C. DNA is comprised of a base, a ribose sugar ring attached to a phosphate group D. RNA has an hydroxyl group on the 3’ carbon of its ribose ring structure E. DNA has an hydroxyl group on the 2’ carbon of its ribose ring structure F. RNA has an hydroxyl group on the 2’ carbon of its ribose...
1. What is NOT TRUE regarding the structure of actin filaments? Group of answer choices A....
1. What is NOT TRUE regarding the structure of actin filaments? Group of answer choices A. The actin filament is formed from one type of protein monomer. B. The filament structure is helical. C. The ends of the filament are the same. D. The filament can breakdown once formed. 2. The concentration of cytoplasmic actin monomers is greater than what is necessary for actin filament polymerization. However, most of the actin protein in the cytoplasm remains in monomer form. Why...
3. Complete the table below. By ATP equivalents, I mean any deoxyribonucleotide or ribonucleotide (dATP, dCTP,...
3. Complete the table below. By ATP equivalents, I mean any deoxyribonucleotide or ribonucleotide (dATP, dCTP, dGTP, dTTP, or ATP are energetically equivalent). Type of damage Does it require? 1.no ATP or ATP equivalents, 2. a few ATP or ATP equivalents, or 3. many ATP or ATP equivalents Does it require new DNA synthesis? Repaired by which specific DNA repair system or systems? Uncorrected mismatch from an error in DNA replication UV-created thymine dimer Alkylation of a base in DNA...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT