Question

Given the DNA template strand 3' GTCGAACGT 5', write the amino acid sequence in the N-terminal...

Given the DNA template strand 3' GTCGAACGT 5', write the amino acid sequence in the N-terminal to the C-terminal direction. Use the three-letter amino acid abbreviations.

Homework Answers

Answer #1

Ans- 3' GTCGAACGT 5',
the sequence of template DNA that is complementary and antiparallel to the above strand of non-template DNA and show its orientation.
the sequence of mRNA that would be made during transcription of the template strand of DNA and show the orientation.
And I must find the sequence of the peptide made from the mRNA during translation, assuming there are no introns. So I deduced that the template strand is: 5' CAGCTTGCA 3',  amino acid sequence in the N-terminal to the C-terminal TABLE-




Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
Answer all questions in sequence, using the oligopeptide. 5’-AACGATGCCATCAGAGCCCAGGACGTGATTTAA-3’ 3’-TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT-5’ 1) Which is the template strand?...
Answer all questions in sequence, using the oligopeptide. 5’-AACGATGCCATCAGAGCCCAGGACGTGATTTAA-3’ 3’-TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT-5’ 1) Which is the template strand? 2) Write each functional strand and underline ea functional codon. Make sure to write 5’/3’ position. 3) Using one theee letter abrev for amino acid, what is the residue sequence? Make sure to label the ends.
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
The sequence below corresponds to a DNA segment in which the bottom strand is the template....
The sequence below corresponds to a DNA segment in which the bottom strand is the template. 3’ –A A T C G C A C A C C G G A G G T A - 5’ 5’ –T T A G C G T G T G G C C T G C A T – 3’ The amino acid residue sequence starting from the N-terminal will be: Select one: a. Met – Glu – Ala – Thr –...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
3'- CCA TGT CCG GAA GTG AAT- 5' Using the same template DNA strand provided in...
3'- CCA TGT CCG GAA GTG AAT- 5' Using the same template DNA strand provided in question #1, transcribe and translate the DNA strand after the following mutations have occurred. You only need to provide the new amino acid sequence of the protein encoded after these mutations have occurred: a. A "C" to "T" base substitution at nucleotide position #8. b. A "T" to "C" base substitution at nucleotide position #6. c. Which one of these is more likely to...