Question

1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions...

1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions proposed by Watson and Crick.

2. Compute for the actual length of the given DNA strand in micrometer. (1m = 10,000Ao)

3’ T T G G A T G A G G A C G C A C C C A C A G A A 5’

5’ A A C C T A C T C C T G C G T G G G T G T C T T 3’

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
3. Genetic Information in E. coli DNA The genetic information contained in DNA consists of a...
3. Genetic Information in E. coli DNA The genetic information contained in DNA consists of a linear sequence of coding units, known as codons. Each codon is a specific sequence of three deoxyribonucleotides (three deoxyribonucleotide pairs in double-stranded DNA), and each codon codes for a single amino acid unit in a protein. The molecular weight of an E. coli DNA molecule is about 3.1 3 109 g/mol. The average molecular weight of a nucleotide pair is 660 g/mol, and each...
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will...
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will be amplified by PCR using short primers:      5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3'      Primers that could be used to amplify this entire DNA fragment are: A) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ B) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ C) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ D) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ E) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
Which of the numbered statements below describe an aspect of DNA structure that directly and specifically...
Which of the numbered statements below describe an aspect of DNA structure that directly and specifically helped scientists infer a mechanism for DNA replication? 1. Hydrogen bonds between paired nucleotides can be broken to unzip the strands 2. The double helix structure of DNA allows it to be packed very tightly in chromosomes. 3. The uniform diameter of a double helix demonstrates nucleotide base-pairing. 4. The number of genes in a single strand of DNA can be matched to another...
This is incorrect with respect to a DNA double helix: A. purines pair with purines B....
This is incorrect with respect to a DNA double helix: A. purines pair with purines B. thymine pairs with cytosine C. the two DNA strands run in parallel (both 3' → 5') D. All of the above 2. Which statement is false? A. In prokaryotes, translation occurs in the cytoplasm at the same time as transcription. B. In prokaryotic cells, DNA is not contained in a true nucleus but in a region called the nucleoid. C. Prokaryotic organisms produce monocistronic...
1)This stretch of DNA includes the beginning of the protein-coding region of a gene. The lower...
1)This stretch of DNA includes the beginning of the protein-coding region of a gene. The lower strand is the template strand. 5’...T A A T G A G T G T T G T T A G T ...3’ .    3’...A T T A C T C A C A A C A A T C A ...5’ ← template strand What is the corresponding mRNA that would be created from this portion of the gene? 2) This stretch of...
A 100 base pair double strand is 20% A 1. How many bases ( in number)...
A 100 base pair double strand is 20% A 1. How many bases ( in number) are T? 2. What percentage of bases are C? 3. How many hydrogen bonds hold the strands together?
A 3 kb double-stranded DNA plasmid is dissolved in water at 1 mg/ml. Given an average...
A 3 kb double-stranded DNA plasmid is dissolved in water at 1 mg/ml. Given an average relative molecular mass per nucleotide of 300, what is the concentration of this plasmid? a) 0.55 µM b)   1.67 µM c) 3.33 µM d)   0.33 µM This question is biochemistry question
1- Using the balanced equation given below, calculate the number of grams of Br 2 needed...
1- Using the balanced equation given below, calculate the number of grams of Br 2 needed to react with exactly 53.8 g of Al. 2Al (s) + 3Br2 = 2AlBr3(s) 2- Calculate the number of moles of CO2 generated by the reaction given below when 6.78 g of CaCO3 is heated. CaCO3 = CaO + CO2(g) 3- Calculate the percent yield of the product if the actual yield is 22.45 g of AlBr3
1.What is the major component of blood plasma? a Nutrients b Ions c Water d Gases...
1.What is the major component of blood plasma? a Nutrients b Ions c Water d Gases 2. How many layers of phospholipids does the cell membrane contain? a 1 b 2 c 4 d 3 3. Which substance stores polysaccharides in plants? a Sucrose b Glycogen c Glucose d Cellulose 4. An important concept in DNA and RNA structure is complementary base pairing. Which tow bases are incorrectly paired? a T-U b A-T c C-G d A-U 5. If the...
1. The average number of minutes spent per day using social media by a population of...
1. The average number of minutes spent per day using social media by a population of college sophomores is 29.6 minutes. If we take a random sample of size n = 87 from this population and find that the sample standard deviation is 7.3 minutes, we know the sampling distribution of the sample mean in this case would have a standard deviation equal to A. 4.05 minutes. B. 1.60 minutes. C. 0.78 minutes. D. 7.30 minutes. E. 3.17minutes. 2. Return...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT