Question

Base-Pairing and Protein Synthesis question: G C C A G A A G G A G...

Base-Pairing and Protein Synthesis question:

G C C A G A A G G A G T C C C C C A C T C T A C T T T G A A A A T A T G T A G

1. Add the complimentary strand by using the base-pair rule.

2. Replicate both strands.

3. Transcribe the DNA, using the original given strand as the non-template strand. (make sure to use the template strand for transcription)

4. Translate the mRNA strand. Include the tRNA molecules lining up along the strand of mRNA. This must include the sequence of anti-codons at the base of the molecule, and the name of the amino acid that would be attached to that particular tRNA molecule.

Homework Answers

Answer #1

1.The given strand

G C C A G A A G G A G T C C C C C A C T C T A C T T T G A A A A T A T G T A G

complimentary strand

CGG TCT TCC TCA GGG GGT GAG ATG AAA CTT TTA TAC ATC

2. Replicate both strands we get

CGG TCT TCC TCA GGG GGT GAG ATG AAA CTT TTA TAC ATC

G C C A G A A G G A G T C C C C C A C T C T A C T T T G A A A A T A T G T A G

3.We have to consider Orginal strand as non template strand . Then the template strand has to made to transcribe

Then we get

G C C A G A A G G A G U C C C C C A C U C U AC U U U G A A A A U A U G UAG

4. When Translating the mRNA strand.

amino acid attaches to tRNA are

alanine,arginine,arginine,serine,proline, proline,leucine,tyrosine, phenylalanine, glutamic acid, asparagine, methionine, stop codon

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
EXERCISE #2 – PROTEIN SYNTHESIS: Protein synthesis has begun and a segment of DNA (a gene)...
EXERCISE #2 – PROTEIN SYNTHESIS: Protein synthesis has begun and a segment of DNA (a gene) is ready for the process. Take the below gene segment through the two stages of protein synthesis: transcription and translation. Write the correct base code (A, C, G, or U) in the boxes below to complete each stage. Finish below by identifying the amino acids which will bond together as a polypeptide chain and, ultimately, produce a protein. Gene Template in DNA Triplets: T...
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT...
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT What would be the effect on the sequences of the mRNA & tRNA & the final protein’s sequence? mRNA: transcribe mRNA using the following from the DNA string: T=A, A=U, G & C pair tRNA: transcribe tRNA using the following from the mRNA string: A & U pair, G & C pair Protein: using the Condon chart and the mRNA strand. What I do...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain Reaction Match the correct answer with the corresponding statement. A base found in RNA but not DNA A base found in DNA but not RNA The opposite directions run by two strands of DNA double helix Protein synthesis When mRNA is synthesized from DNA When a strand of DNA makes a new copy prior to cell division The RNA that carries amino acids to...
Fill in the complementary DNA strand: A T G G C T G A T T...
Fill in the complementary DNA strand: A T G G C T G A T T G A ___________________________________ Which enzyme is involved with adding new deoxynucleotides during DNA replication? ___________________________ Who were the three scientists who got the credit for discovering that DNA was a double helix and the exact structure? _______________________ _______________________ _______________________ During transcription ____________ is made. During translation _____________ is made. The energy source for DNA replication is ________ and for transcription is ____________ The energy...
Gene expression is complex, requiring many macromolecules and events. This means....lots of vocabulary terms!!! Complete this...
Gene expression is complex, requiring many macromolecules and events. This means....lots of vocabulary terms!!! Complete this matching to show me your mastery of the language. You may want to read the introduction to Lab 15: Gene Expression. molecule that serves as a template for mRNA synthesis name of the process my which RNA is made name of the enzyme that makes RNA direction of RNA synthesis where transcription occurs in prokaryots where transcription happens in eukaryots where RNA polymerase binds...
Q1 : put the following of protein synthesis transcription steps in the correct order A- the...
Q1 : put the following of protein synthesis transcription steps in the correct order A- the RNA-pol stops transcribed when reaching a repetitive sequences of T nucleotides B- the 3"segments of the nascent RNA hybridizes with the DNA template , and its 5'end extends out the transcription C- after DNA transcription passes , the two DNA strands reform D- RNA-pol start move on the DNA template melting and unwinding the double helix F- the transcript RNA strand is released G-...
Q2 An open reading frame (ORF) is a section of codons that begins with a start...
Q2 An open reading frame (ORF) is a section of codons that begins with a start codon and ends with a stop codon. Each codon specifies for a specific amino acid. ORF is the part of a gene that after transcription into an mRNA gets translated into a protein. With the help of several translation factors and enzymes, ribosomes translate mRNAs into proteins. The following DNA sequence contains a complete open reading frame (ORF) of a short transcriptional unit. The...
The base-pairing rules for DNA state that ______. a.T pairs with C, A pairs with G...
The base-pairing rules for DNA state that ______. a.T pairs with C, A pairs with G b. any combination of bases is allowed c.A pairs with T, C pairs with G d. C pairs with A, T pairs with G If a strand of DNA has the sequence CGGTATATC, then the complementary strand of DNA has the sequence _____. a.ATTCGCGAT b. GCCCGCGCT c.GCCATATAG d. TAACGCGCT Mutation_____. a.can produce new alleles b. can be harmful, beneficial, or neutral c.is a change...
Write the mRNA that would form for the following section of DNA. For each codon in...
Write the mRNA that would form for the following section of DNA. For each codon in the mRNA, write the amino acid that would be placed in the protein by a tRNA. 3.1. DNA strand: 3’—CCC—TCA—GGG—CGC—5’ mRNA: —______—______—______—______— amino acid order _______—_______—_______—_______ 3.2. DNA: 3’—ATA—GCC—TTT—GGC—AAC—5’ mRNA: —______—______—______—______—______— amino acid order —_______—_______—_______—_______—_______ • If a base substitution in DNA ( G replaces C in DNA ) ,changes the second codon in mRNA, how is the amino acid sequence affected in the...
Protein synthesis requires energy in the form of ATP and GTP. Two high-energy phosphate bonds (from...
Protein synthesis requires energy in the form of ATP and GTP. Two high-energy phosphate bonds (from ATP) fuel the formation of one aminoacyl tRNA. Formation of the initiation complex requires energy from one GTP. Delivery of each new tRNA to the Asite requires one GTP. Termination requires the hydrolysis of one GTP.   Based on this information, the table of codons, and your understanding of the processes of Activation, Initiation, Elongation, and Termination, answer the following questions. How many high energy...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT