Question

can aninals digest proteoglycans or glycoproteins?

can aninals digest proteoglycans or glycoproteins?
Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Answer-Animals can digest both but at some extent. Explanation-In case if glycoprotein the proteolytic and glycosidic digestion happens but sometimes incomplete due to steric hindrance in the presence of bulky oligisacchaoligo.glycoproteins are delivered to lysosome for catabolism either by endocytosis or by autophagy withing the cell.

In case of proteoglycan it is digested by Bacteroides thetaiotaomicron,a human colonic anaerobe.cella of B.thetaiotaomicron are able to digest chondroitin sulphate in proteoglycan.And trypsin also can digest proteoglycan .

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Restriction digest B: ATTGAATTCCGGTTAGCTTTACAATTCCGCCATATGCGCAATTGGAATTCC 1. Now compare the same region of DNA...
Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Restriction digest B: ATTGAATTCCGGTTAGCTTTACAATTCCGCCATATGCGCAATTGGAATTCC 1. Now compare the same region of DNA from another individual (digest B). Where would EcoRI cut? How many fragments are formed? Restriction digest B: ATTGAATTCCGGTTAGCTTTACAATTCCGCCATATGCGCAATTGGAATTCC a. Number of bases in each fragment:
Create a protocol for a restriction digest with a total volume of 30 µl to digest...
Create a protocol for a restriction digest with a total volume of 30 µl to digest 1.0 µg of plasmid DNA to completion. You have a restriction enzyme in a standard 50% glycerol at 5 Units / µl but wish to do a standard 'overdigestion' in which you will put the maximum allowable enzyme in the digest. (Indicate how many Units will be in the digest.) You have a compatible 10X restriction buffer, and your DNA is at 0.3 µg...
The hardness of bone comes from _______________, whereas _________________ provide(s) some degree of flexibility. Group of...
The hardness of bone comes from _______________, whereas _________________ provide(s) some degree of flexibility. Group of answer choices A. Calcium carbonate; calcium phosphate B. Proteins; collagen C. Hydroxyapatite and other minerals; collagen fibers D. Glycoproteins; proteoglycans E. collagen and elastic fibers; minerals
What is true about enzymes that can digest lipids? A. all lipases are secreted as zymogens...
What is true about enzymes that can digest lipids? A. all lipases are secreted as zymogens B. gastric and lingual lipase function best in a low pH C. all lipases begin digesting lipids in the location that they are secreted D. pancreatic lipase is secreted by the same cell type that secretes pepsinogen
How to construct or figure out a restriction digest map
How to construct or figure out a restriction digest map
Why would the inability to digest lactose cause diarrhea?
Why would the inability to digest lactose cause diarrhea?
4) Answer the following briefly: a) The ECM functions in more than support and adhesion, what...
4) Answer the following briefly: a) The ECM functions in more than support and adhesion, what other functions does it have? b) How and where is a GAG synthesized? What is the function? How is hyaluronan different? c) What are proteoglycans, where and how is it made? What is the function? d) What are some examples of cell adhesive glycoproteins? What is their function? e) What are the fibers that make up the extracellular matrix? What are their structural properties?
Which of the following is a function of proteins? main component of the cell membrane digest...
Which of the following is a function of proteins? main component of the cell membrane digest cell waste genetic material quick energy enzymes
The goal of the polymerase chain reaction (PCR) is to: Cleave DNA molecules Digest bacterial plasmids...
The goal of the polymerase chain reaction (PCR) is to: Cleave DNA molecules Digest bacterial plasmids Amplify a small amount of DNA sequence Sequence DNA
Explain why we see different bands for different people following the restriction digest of the PCR...
Explain why we see different bands for different people following the restriction digest of the PCR product (the TAS2R38 gene specifically).
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT