Question

Which protein—(a) clathrin or (b) a transcription factor—would be most likely to have a selectively exposed...

Which protein—(a) clathrin or (b) a transcription factor—would be most likely to have a selectively exposed nuclear localization sequence? Why?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

clathrin is a protein which has a triskelion structure, it binds to the membrane and causes the invagination of the membrane which facilitates the formation of vesicles, clathrin protein does not have nuclear localization signal it does not have to translocate to the nucleus, it functions in the cytosol.

transcription factors are translated in the cytosol and it has to translocate to the nucleus to function, transcription factors bind to the specific sequences on the DNA and regulate the expression of the genes.

for proteins to translocate to the nucleus from the cytosol, it has to have a nuclear localization signal, so transcription factors have nuclear localization signal.

so the answer is b)a transcription factor

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
1. Which cytosolic factor is most likely to associate with the signal sequence of a protein...
1. Which cytosolic factor is most likely to associate with the signal sequence of a protein that is targeted co-translationally to the ER? A chaperone of the Hsp70 family The translocation channel The ribosome Signal recognition particle (SRP) Signal peptidase 2. What is the most likely fate of a protein with an N-terminal hydrophobic sorting signal and an additional internal hydrophobic domain of 22 amino acids? The protein stays in the cytosol The protein is transported to mitochondria Because the...
Which of the following mutations would likely have the most dramatic effect on protein structure, and...
Which of the following mutations would likely have the most dramatic effect on protein structure, and why? Which would likely have the least dramatic effect?   a. changing one purine for another in the first position of a codon. b. changing one pyrimidine for another in the second position of a codon. c. changing a purine with a pyrimidine in the second position of a codon. d. changing a pyrimidine for another pyrimidine at the third position of a codon. PLEASE...
A signal transduction cascade with amplification will most likely occur after the activation of a(n) ___...
A signal transduction cascade with amplification will most likely occur after the activation of a(n) ___ receptor. a. Nuclear b. Desmosomal c. Ion Channel d. G Protein coupled Lipophilic/Diffusible signals are typically going to activate what type of receptor? a. G protein coupled b. ion channel c. desmosomal d. nuclear During receptor mediated endocytosis, which proteins pucker the membrane? a. The receptor b. the rough ER c. Clathrin d. Dynamin
24. TBP is a protein subunit of the general transcription factor TFIID. What is the term...
24. TBP is a protein subunit of the general transcription factor TFIID. What is the term (acronym) used to name the other protein subunits found in TFIID? 25. The sequence below represents a 5’ region of a particular mRNA (assume that the t’s are u’s), containing a portion of the 5’UTR and the ORF: 5’…gacggactgttctatgactgcaaagatggaa… Taking into account the function of the start codon, what would by the amino acid sequence produced from the above portion of mRNA? 26. The...
a. Which DNA mutation is more likely to have a detrimental effect on the protein it...
a. Which DNA mutation is more likely to have a detrimental effect on the protein it codes for: a 2 base pair deletion from the middle of the coding sequence of a gene, or a 12-base pair deletion from the same region of the gene? Explain why? b. Would the outcome be different if the deletions happened within the gene’s intron? Explain why?
Gene X encodes protein X, which normally functions as a transcription factor, regulating the expression of...
Gene X encodes protein X, which normally functions as a transcription factor, regulating the expression of certain genes. A particular mutant allele of gene X is created by a frameshift mutation; the protein encoded by this mutation has kinase activity, meaning it acts as an enzyme that phosphorylates other proteins. This mutation is an example of A. a gain-of-function mutation. B. a loss-of-function mutation. C. a neomorphic mutation. A and C B and C
Gene X encodes protein X, which normally functions as a transcription factor, regulating the expression of...
Gene X encodes protein X, which normally functions as a transcription factor, regulating the expression of certain genes. A particular mutant allele of gene X is created by a frameshift mutation. The protein encoded by this mutant allele has kinase activity, meaning it acts as an enzyme that phosphorylates other proteins. This mutation is an example of A. a loss-of-function mutation. B. a gain-of-function mutation. C. a neomorphic mutation. A and C B and C
What would happen to a protein like signal peptidase if you removed its signal peptide but...
What would happen to a protein like signal peptidase if you removed its signal peptide but added a nuclear localization signal (NLS)? It would end up in the nucleus. It would end up in the cytoplasm It would be secreted None of the above What would happen to a secreted protein (e.g. insulin) if you produced it from an mRNA missing the sequence encoding the signal peptide? It would be properly secreted, though it might not fold correctly. It would...
Which of the following reaction categories would be most likely to have the lowest ΔG value?...
Which of the following reaction categories would be most likely to have the lowest ΔG value? Select one: a. Catalyzed Endergonic Reaction b. Catalyzed Exergonic Reaction c. Uncatalyzed Endergonic Reaction d. Uncatalyzed Exergonic Reaction e. A and B f. A and C g. B and D h. C and D -- Upon activation of a G protein-coupled receptor, the G protein converts a GDP into a GTP Select one: True False --
Which of the following is most likely to be the result of a mutation in the...
Which of the following is most likely to be the result of a mutation in the promoter of a gene A. The majority of the protein sequence is altered. B. Only one codon is altered. C. The level of expression of the gene is altered. D. The reading frame of the gene is altered.
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT