Question

Using the genetic code table, please answer the following questions: a) Transcribe and translate the following...

Using the genetic code table, please answer the following questions:

a) Transcribe and translate the following DNA. Label any nucleic acids with their 5’ and 3’ ends.

DNA 3’ TACATAACCATT 5’

b) Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a silent mutation.

c) Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a nonsense mutation.

d) Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a missense mutation in the second amino acid.

Homework Answers

Answer #1

A- Upon transcription, we will get

5' AUGUAUUGGUAA 3'

Methionine- Tyrosine- Tryptophan- Stop codon

B- A silent mutation is a mutation in which upon mutation new codon translate same amino acid.

3' TAC ATG ACC ATT 5'

Methionine- Tyrosine- Tryptophan- Stop codon

C- A nonsense mutation leads to premature termination of translation

3' TAC ATT ACC ATT 5'

Methionine- Stop codon

D- Mis-sense mutation leads to translation of new amino acid.

3' TAC GTA ACC ATT 5'

Methionine- Histidine- Tryptophan- Stop codon

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´
A. Using the genetic code table, answer the following questions: Determine the sequence of amino acids...
A. Using the genetic code table, answer the following questions: Determine the sequence of amino acids from an mRNA sequence CCGUGU Determine the sequence of amino acids from a DNA template strand AATGTT List the start codon List the stop codons
DNA sequence. 5’-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT-3’ “Transcribe” and form an RNA transcript based on the DNA sequence. Illustrate the...
DNA sequence. 5’-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT-3’ “Transcribe” and form an RNA transcript based on the DNA sequence. Illustrate the amino acid sequence of the resulting polypeptide using the genetic code. *Please follow proper directionality of both the RNA strand and the polypeptide. Indicate clearly and label correctly the ends of the molecules mentioned. What is/are the characteristic feature/s of the resulting polypeptide based on the viral DNA sequence given?
A mRNA for a common protein (DOG) is written below. (use the genetic code to translate...
A mRNA for a common protein (DOG) is written below. (use the genetic code to translate directly). AUG CUC ACU AAU GGU UCU CAU GGG UGA A missense mutation has occurred however and the new gene (CAT) is transcribed below. Translate it using the genetic code. AUG CUC ACU AAU GGU CCU CAU GGG UGA Using the translated products describe DOG and CAT in terms of potential glycosylation. Could DOG be glycosylated, if so, on which amino acids and by...
During cell division, DNA undergoes replication. DNA is transcribed into mRNA and the genetic code is...
During cell division, DNA undergoes replication. DNA is transcribed into mRNA and the genetic code is translated into a polypeptide sequence. Out of these three processes, which is most likely to be the site a deletion, frameshift, insertion missense, nonsense, point and silent mutation or alteration occurred? Explain why you have chosen this process.
1.a) In the genetic code, the codon GAU encodes _________. Select one: a. Aspartic acid. b....
1.a) In the genetic code, the codon GAU encodes _________. Select one: a. Aspartic acid. b. Asparagine. c. Terminator (stop codon). d. Serine. e. Methionine (initiator codon). b) An individual with the genetic condition cystic fibrosis has a CFTR protein with the amino acid histidine at position 482. The normal CFTR protein has arginine. at position 482. No other changes are observed in the protein. This is change is likely the result of a _________ mutation. Select one: a. Frameshift....
1. Three mutations are listed below for the following mRNA at the positions they occur. Using...
1. Three mutations are listed below for the following mRNA at the positions they occur. Using the genetic code on page 304 of your text determine if the mutation causes a silent, missense or nonsense mutation. 5’ AUG GUC UCA GAC CGG UUA 3’ Mutant 1 A in position 12 Mutant 2 A in position 8 Mutant 3 A in position 13 A. nonsense B. silent C. missense
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first...
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first 2 amino acids that will be joined at the ribosome? Remember there is a START codon. Use the information on this chart to answer the question. asparagine, alanine methionine, glutamine leucine, glycine leucine, phenylalanine methionine, lysine The mutation in the above question is an example of a ________________ mutation. Group of answer choices frameshift nonsense missense silent
You identify a gene from E. coli that is very small. Using recombinant DNA technology, you...
You identify a gene from E. coli that is very small. Using recombinant DNA technology, you managed to clone the whole piece of DNA that contains all codons (including stop and start codons) for protein synthesis. Using automated sequencing, you obtain the following sequence: 5’-TTAATATCAAGCTGATTCAGGCCCAAACATCCT-3’ A. Using the above sequence for reference, write out the mRNA transcript (be sure to label the 5' and 3' ends). B. Translate the protein that is coded for by the mRNA strand. C. How...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT