Question

Explain why a polynucleotide strand has a natural coil to it and why the complementary strands...

Explain why a polynucleotide strand has a natural coil to it and why the complementary strands must be anti-parallel?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

The natural coil is present because of hydrogen bonding between adjacent nucleotides.

As we know that there are two types of bases-

purines and pyrimidines.

Purine- Adenine, Guanine

Pyrimidine- Thymine and Cytosine.

According to watson and crick bonding....

Purine pairs with pyrimidine.

A=T

G C. There are two hydrogen bonds between A & T. Three hydrogen bonds between G&C.

I am attaching an image.. this will make it clear that to make hydrogen bonding the strands have to be in antiparallel direction.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
AAACAAAATCCTAACCACGTTTGGTGGGAAGTATCTGCCCACGTT TTTGTTTTAGGATTGGTGCAAACCACCCTT CATAGACGGGTGCAA From the two complementary strands, identify the coding strand and the template strand...
AAACAAAATCCTAACCACGTTTGGTGGGAAGTATCTGCCCACGTT TTTGTTTTAGGATTGGTGCAAACCACCCTT CATAGACGGGTGCAA From the two complementary strands, identify the coding strand and the template strand with polarity labeling. Find the start codon in the open-reading frame in a 5' to 3' direction. Find the stop codon in the 5' to 3' direction. Does this strand belong to a prokaryotic or eukaryotic organism?
1. The strand that has stopped following the splitting of the original strands is called the...
1. The strand that has stopped following the splitting of the original strands is called the ____________ strand. 2. The strand moving away from the splitting of the original strands is called the _______________ strand. 3. The strand from #1 is done in fragments. These are called __________.   4. How are these fragments connected together?
one strand of a DNA molecules has the sequence of 5' ATGCAGA 3' the complementary strand...
one strand of a DNA molecules has the sequence of 5' ATGCAGA 3' the complementary strand would have the sequence is 3'TACGTCT5' ????
RNA interference (RNAi) is a natural process by which cells suppress the activity of specific genes...
RNA interference (RNAi) is a natural process by which cells suppress the activity of specific genes by targeting and degrading mRNA. One way RNAi has been harnessed by agricultural scientists is to protect plants from pest attacks on the roots of corn plants. Choose the answer below that correctly describes the steps in the RNAi process that eventually result in degradation of the target mRNA. 1. The protein Dicer recognizes double-stranded RNA (dsRNA) 2. Dicer cuts up the dsRNA into...
A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
Why is it important to align the Helmholtz coil, so that its field is anti-parallel to...
Why is it important to align the Helmholtz coil, so that its field is anti-parallel to the earth's magnetic field? Include diagrams if possible.
A DNA strand individually has 3 different reading frames. Why? Explain your answer. A. multiple reading...
A DNA strand individually has 3 different reading frames. Why? Explain your answer. A. multiple reading frames exist on both DNA strands B. 3 different polypeptide sequences exist C. multiple methionine amino acids are in a polypeptide D. codon sequences can be read in 3 different ways E. open reading frame can be determined by wobble
Why do purine:purine and pyrimidine:pyrimidine complements not exist? a.Because purines form 3 Hydrogen bonds and pyrimidines...
Why do purine:purine and pyrimidine:pyrimidine complements not exist? a.Because purines form 3 Hydrogen bonds and pyrimidines only 2 b.Because the anti-parallel arrangement of DNA strands prevents them. c.If only purine:pyrimidine pairs are permitted the helix will remain uniform in width from end to end. d.Because DNA polymerase cannot initiate strand synthesis on its own.
Explain why a policy aimed at lowering the natural rate of unemployment given by the steady...
Explain why a policy aimed at lowering the natural rate of unemployment given by the steady state model must either reduce the rate of job separation or increase the rate of jobs finding
can natural selection act on a trait if it has a heritibility of R2 0.1225? explain...
can natural selection act on a trait if it has a heritibility of R2 0.1225? explain why or why not using the requiremnents of natural selection???
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT