Question

You will need to read the following article “In Iceland’s DNA Clues to Disease” (in your problem sets folder in CANVAS). The article describes the results obtained by researchers at deCODE, a genetics firm in Iceland. Their goal was to harness Iceland’s unique homogenous population with low genetic diversity coupled with excellent geneology records to uncover rare genetic mutations that could lead to disease. The research article (known as a primary source) for the information above was published in the journal Nature Genetics [Gudbjartsson et al., Nature Genetics 47, 435 (2015)]. In the study they report that early onset atrial fibrillation (a type of irregular heartbeat), can be correlated with a deletion mutation in a gene called MYL4. The nature of the exact mutation in the MYL4 gene is a deletion of cytosine (C) at the 234th nucleotide position of the coding DNA sequence of MYL4

Shown below is the coding sequence for MYL4 retrieved from the NCBI gene sequence database (NM_001002841.1). [Note: this is the strand of DNA that runs in the 5’-3’ direction]

1. atggctccca agaagcctga gcctaagaag gaggcagcca agccagctcc

51. agctccagct ccagcccctg caccagcccc tgccccagct cctgaggctc

101. ccaaggaacc tgcctttgac cccaagagtg taaagataga cttcactgcc

151. gaccagattg aagagttcaa agaggccttt tcattgtttg accggacccc

201. [gactggagag atgaagatca cctacggcca gtgcggggat gtactgcggg

251. ccctgggcca gaaccctacc aatgccgagg tgctgcgtgt gctgggcaag]

301. cccaagcctg aagagatgaa tgtcaagatg ctggactttg agacgttctt

351. gcccatcctg cagcacattt cccgcaacaa ggagcagggc acctatgagg

401. acttcgtgga gggcctgcgt gtctttgaca aggagagcaa tggcacggtc

451. atgggtgctg agcttcggca cgtccttgcc accctgggag agaagatgac

501. tgaggctgaa gtggagcagc tgttagctgg gcaagaggat gccaatggct

551. gcatcaatta tgaagccttt gtcaagcaca tcatgtcagg gtga

Design a set of primers (each 10 bp in length) to PCR amplify a 100 bp region [from nucleotide 201 to 300- bracketed] containing the mutation in MYL4 gene.

a) Write the sequence of the Forward Primer (labeling the 5’ and 3’ end)

b) Write the sequence of Reverse Primer/Oligonucleotide (label the 5’ and 3’ end)

Answer 1

Given sequence is :

gactggagag atgaagatca cctacggcca gtgcggggat gtactgcggg

ccctgggcca gaaccctacc aatgccgagg tgctgcgtgt gctgggcaag

On running BLAST for the given sequence, it showed similarity search with the Homo sapiens myosin light chain MYL4 mRNA.

1. Appropriate forward primer which ids 20 bp in length is as follows: AAGATCACCTACGGCCAGTG

2. Appropriate Reverse primer which is 19 bp in length is as follows: CAGCACCTCGGATTGGTA

Primers have been checked for self loop formation and temperature