Question

how is an mRNA codon sequence decoded into a protein sequence

how is an mRNA codon sequence decoded into a protein sequence

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Answer

To decode the mRNA codon sequence into protein sequence or amino acid sequence it is necessary to confirm the correct reading frame. The mRNA is arranged into triplet bases which is called codons.

once the start codon or initation codon ( i.e, AUG it is called start or initation codon as it begins to synthesis the polypeptide chain and also codes for Amino acid methionine) has been located and their reading frame is fit to establish, the corresponding protein sequence can be deducing the genetic code

for example  mRNA :-  GUAUGCACGUGACUUUCCUCAUGAGCUGAU

The codons will be- GU - AUG - CAC - GUG - ACU - UUC - CUC - AUG - AGC - UGA - U

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A codon is a series of three bases in mRNA which is equivalent to the 3...
A codon is a series of three bases in mRNA which is equivalent to the 3 bases in DNA; this triplet code corresponds to one amino acid. Once the mRNA is attached to a ribosome, it can assemble the protein by translating from the “language” of nucleic acids to the “language” of amino acids. What is the processed called? In order to synthesize a protein molecule, amino acids need to be aligned in the proper sequence along the RNA sequence....
*A DNA template sequence is 3’ ATG 5’. The complimentary mRNA codon sequence is: A 5’...
*A DNA template sequence is 3’ ATG 5’. The complimentary mRNA codon sequence is: A 5’ TAC 3’      B 5’ UAC 3’      C 3’ TAC 5’      D 3’ UAC 5’
Write the mRNA that would form for the following section of DNA. For each codon in...
Write the mRNA that would form for the following section of DNA. For each codon in the mRNA, write the amino acid that would be placed in the protein by a tRNA. 3.1. DNA strand: 3’—CCC—TCA—GGG—CGC—5’ mRNA: —______—______—______—______— amino acid order _______—_______—_______—_______ 3.2. DNA: 3’—ATA—GCC—TTT—GGC—AAC—5’ mRNA: —______—______—______—______—______— amino acid order —_______—_______—_______—_______—_______ • If a base substitution in DNA ( G replaces C in DNA ) ,changes the second codon in mRNA, how is the amino acid sequence affected in the...
The nucleotide sequence of a DNA codon is CTA. A messenger RNA molecule with a complementary...
The nucleotide sequence of a DNA codon is CTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon? Select one: a. GAU b. GAT c. CTA d. CTA e. CUA
First, translate the following mRNA sequence into an amino acid sequence mRNA sequence : A U...
First, translate the following mRNA sequence into an amino acid sequence mRNA sequence : A U G U C C U U U U A A Amino acid sequence : ______ ______ ______ ______ Second, create a single base substitution in the second codon of the above mRNA sequence that: a) changes the resulting amino acid into a Cys ___________ b) causes a silent mutation ___________
Part A: Using a codon table, translate this section of mRNA 5’ ----CGGAUUCUCGGGAAC---- 3’ Part B:...
Part A: Using a codon table, translate this section of mRNA 5’ ----CGGAUUCUCGGGAAC---- 3’ Part B: A bacterium has this sequence for the same piece of mRNA: 5’ ----CGGAUUCACGGGAAC---- 3’ What type of mutation does this represent? Explain the consequences of this mutation on the protein AND on the cell.
A protein molecule consists of the sequence alanine, leucine, tyrosine, serine, leucine. What sequence of mRNA...
A protein molecule consists of the sequence alanine, leucine, tyrosine, serine, leucine. What sequence of mRNA codons would be responsible for forming this protein?
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
1. The mature mRNA molecule for the EDS1 transcript is 1903 nucleotides long, starting with an...
1. The mature mRNA molecule for the EDS1 transcript is 1903 nucleotides long, starting with an initiation codon at one end and a termination codon at the other end. The number of amino acids in the protein translated from this mRNA is: 2. You’ve just determined the first four amino acids in the amino-terminal end of a the EDS1L Arabidopsis protein. The peptide sequence is: (NH4)- met-ala- phe-glu- (COOH). What is the nucleotide sequence in the portion of the mRNA...
A) Complete the following diagram by giving the template sequence, the mRNA sequence and peptide sequence.(The...
A) Complete the following diagram by giving the template sequence, the mRNA sequence and peptide sequence.(The genetic code is provided below)Complete the following diagram by giving the template sequence, the mRNA sequence and peptide sequence.(The genetic code is provided below) Coding:            5’ GCT GAT CAG CTG ACC GAA GAA CAG ATT 3’ Template:     3’ ___ ___ ___   ___ ___ ___ ___   ___ ___ 5’ mRNA:            5’ ___ ___ ___ ___ ___ ___ ___   ___ ___ 3’ Protein:                  N   ...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT