Question

If you mutated one base pair in a restriction site, how would the banding pattern change...

If you mutated one base pair in a restriction site, how would the banding pattern change on a gel? Please describe?

Homework Answers

Answer #1

Restriction sites are the specific (4-8 bp) sequence of nucleotides located on a DNA molecule which is recognised by the restriction enzymes. A particular restriction enzyme may cleave the DNA between two nucleotides within its restriction sites.

E.g., EcoR1 recognises the GAATTC and cuts in between the G and A on both strands. If we mutate the GAATTC to GTATTC will eliminates the restriction site for the EcoR1. The loss of restriction site would results in replacement of two small bands by single large band on the gel.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
You digest a plasmid with a restriction enzyme that recognizes a single site on the plasmid....
You digest a plasmid with a restriction enzyme that recognizes a single site on the plasmid. When you perform gel electrophoresis on the digestion product, you quickly realize that there are two bands; one at the expected size and one near the well. Which of the following best explains the outcome? DNA was trapped in the agarose gel The presence of the chromosomal DNA Some plasmids were not digested The some plasmids ligated together
If two bands, one expected size and one near the well, appears after performing a restriction...
If two bands, one expected size and one near the well, appears after performing a restriction digestion and a gel electrophoresis on a plasmid with a single restriction site, what does the band near the well represent? Does it mean that some plasmids were not digested? Or does it mean that some plasmids were ligated together? What would be the result of these two conditions on a gel?
How would one determine what weak acid/conjugate base pair would go into the creation of a...
How would one determine what weak acid/conjugate base pair would go into the creation of a buffer? Suppose you need to keep the pH of a solution near pH 2.5. Find a combination that you would use.
How would you expect the lanes on a gel to differ if you cut the same...
How would you expect the lanes on a gel to differ if you cut the same DNA with each type of Restriction enzyme and why? (3)
15. In the given sequence, aaccggtaaacaagtccccaaacccactagtccctttgaaaaaggg The gene you are interested has one palindromic site for...
15. In the given sequence, aaccggtaaacaagtccccaaacccactagtccctttgaaaaaggg The gene you are interested has one palindromic site for restriction enzyme X and another site for enzyme Q, the distance between these two motifs are how many nucleotides?
What base sequence would pair with the following? 6pts AUGCCUAAAGUC Is the above sequence from DNA...
What base sequence would pair with the following? 6pts AUGCCUAAAGUC Is the above sequence from DNA or RNA? How can you tell
Light is diffracted through a single slit. How would the diffraction pattern on the screen change...
Light is diffracted through a single slit. How would the diffraction pattern on the screen change if the slit were made narrower? Explain.
In Young’s double-slit experiment, how would the interference pattern change if white light is used?
In Young’s double-slit experiment, how would the interference pattern change if white light is used?
1) How would the interference pattern produced by a diffraction grating change if the laser light...
1) How would the interference pattern produced by a diffraction grating change if the laser light changed from red to blue? 2) How do the interference patterns produced by a CD and diffraction grating compare? Explain similarities, differences, and causes in your answer.
If Young's double slit experiment were submerged in water (n=1.33), how would the inteference pattern change?
If Young's double slit experiment were submerged in water (n=1.33), how would the inteference pattern change?
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT