Question

Q2 An open reading frame (ORF) is a section of codons that begins with a start...

Q2 An open reading frame (ORF) is a section of codons that begins with a start codon and ends with a stop codon. Each codon specifies for a specific amino acid. ORF is the part of a gene that after transcription into an mRNA gets translated into a protein. With the help of several translation factors and enzymes, ribosomes translate mRNAs into proteins. The following DNA sequence contains a complete open reading frame (ORF) of a short transcriptional unit. The DNA sequence of only one strand of the double-stranded DNA is shown here. 5` CATGCGGAGTCGTTGGTATTGA 3`. Answer the following questions

a. Write the complete sequence of both strands of the double-stranded DNA.

b. Identify the coding strand and write the complete sequence of the coding strand. Label the 5` and 3` ends of the nucleotide sequence.

c. Derive and write the sequence of the transcribed mRNA. Identify the 5` and 3` ends of the nucleotide sequence.

d. Using the universal codon table, generate the amino acid sequence (three-letter code) from the mRNA and identify the N- and C-terminal ends.

e. Deduce the sequence of anticodon in tRNA that carried the C-terminus amino acid of this polypeptide?

f. By mutation, a nucleotide base ‘A’ is inserted after base position 6 of the coding strand. Deduce the amino acid sequence that will result from the mutated DNA.

Homework Answers

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Introns are known to contain stop codons (UAA, UGA, or UAG), yet these codons do not...
Introns are known to contain stop codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? a. More than one stop codon is needed to stop transcription. b. Exons are spliced out of mRNA before translation. c. These triplets do not cause termination in gene expression. d. Stop codons are only required for termination of mRNA synthesis. e. Introns are removed from mRNA before translation A(n) _____ is located upstream of a...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
Use the information above to answer the following questions. 5’…TAC ACC GAT GGA TAA GTC…3’ DNA...
Use the information above to answer the following questions. 5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand ONLY answer E and F please!! The rest is for reference!! A. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points B. Write the sequence of the mRNA strand...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
Shown is a stretch of DNA containing a promoter and a very small open reading frame...
Shown is a stretch of DNA containing a promoter and a very small open reading frame (ORF).  What is the base of the first nucleotide in the RNA transcript that would be produced from this gene? Group of answer choices C U A G T
Write the mRNA that would form for the following section of DNA. For each codon in...
Write the mRNA that would form for the following section of DNA. For each codon in the mRNA, write the amino acid that would be placed in the protein by a tRNA. 3.1. DNA strand: 3’—CCC—TCA—GGG—CGC—5’ mRNA: —______—______—______—______— amino acid order _______—_______—_______—_______ 3.2. DNA: 3’—ATA—GCC—TTT—GGC—AAC—5’ mRNA: —______—______—______—______—______— amino acid order —_______—_______—_______—_______—_______ • If a base substitution in DNA ( G replaces C in DNA ) ,changes the second codon in mRNA, how is the amino acid sequence affected in the...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain Reaction Match the correct answer with the corresponding statement. A base found in RNA but not DNA A base found in DNA but not RNA The opposite directions run by two strands of DNA double helix Protein synthesis When mRNA is synthesized from DNA When a strand of DNA makes a new copy prior to cell division The RNA that carries amino acids to...
Here’s an uncompleted table of a segment of the transcribed region of a gene in a...
Here’s an uncompleted table of a segment of the transcribed region of a gene in a prokaryote. Fill in the empty slots of this table with the appropriate nucleotide/amino acid based on the information you have here. (This requires that you use your awesome knowledge from previous weeks in this unit as well, but you can do it! I know this is challenging, but it’s not impossible. You have enough information here to crack this thing wide open.) DNA double...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT