Question

Q2 An open reading frame (ORF) is a section of codons that begins with a start codon and ends with a stop codon. Each codon specifies for a specific amino acid. ORF is the part of a gene that after transcription into an mRNA gets translated into a protein. With the help of several translation factors and enzymes, ribosomes translate mRNAs into proteins. The following DNA sequence contains a complete open reading frame (ORF) of a short transcriptional unit. The DNA sequence of only one strand of the double-stranded DNA is shown here. 5` CATGCGGAGTCGTTGGTATTGA 3`. Answer the following questions

a. Write the complete sequence of both strands of the double-stranded DNA.

b. Identify the coding strand and write the complete sequence of the coding strand. Label the 5` and 3` ends of the nucleotide sequence.

c. Derive and write the sequence of the transcribed mRNA. Identify the 5` and 3` ends of the nucleotide sequence.

d. Using the universal codon table, generate the amino acid sequence (three-letter code) from the mRNA and identify the N- and C-terminal ends.

e. Deduce the sequence of anticodon in tRNA that carried the C-terminus amino acid of this polypeptide?

f. By mutation, a nucleotide base ‘A’ is inserted after base position 6 of the coding strand. Deduce the amino acid sequence that will result from the mutated DNA.

Answer 1