Question

Construct a drawing of the process by which a DNA code is converted into an amino...

Construct a drawing of the process by which a DNA code is converted into an amino acid sequence

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

The given diagram is the perfect to tell the process that how DNA is converted into the amino acid sequence. This process is called translation. The mRNA is made by the DNA through transcription. For every set of code there is amino acid that come togather with the help of tRNA.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
4. Which statement describes the central dogma of biology? a) DNA is transcribed into RNA. RNA...
4. Which statement describes the central dogma of biology? a) DNA is transcribed into RNA. RNA is translated into an amino acid sequence. b) Translation is the process of synthesizing RNA from DNA. Transcription is the process of synthesizing an amino acid sequence from RNA. c) Transcription is the process of synthesizing DNA from RNA. Translation is the process of synthesizing an amino sequence from DNA. d) DNA is transcribed to an amino acid sequence. RNA is translated to an...
The central dogma is a two-step process by which the sequence of base pairs in DNA...
The central dogma is a two-step process by which the sequence of base pairs in DNA determines the sequence of amino acids that make up the corresponding protein. For each step, describe the main goal and the location in which the process takes place in a mammalian cell. Predict the corresponding amino acid for the portion of the DNA strand that reads ‘GTT’. How is the corresponding amino acid affected if there is a genetic mutation and the template now...
Explain why is it impossible to take the amino acid sequence and determine the exact DNA...
Explain why is it impossible to take the amino acid sequence and determine the exact DNA code? (Detailed)
How can four types of DNA nucleotides code for twenty different amino acid types? a. Purines...
How can four types of DNA nucleotides code for twenty different amino acid types? a. Purines and pyrimidines form tRNA codes for each specific amino acid b. Combinations of two purines and pyrimidines form codes for specific amino acids c. Combination of two purines and pyrimidines form twenty codes for amino acids d. Combinations of three of the four DNA nucleotide types can form sixty-four codes e. Each purine and pyrimidine form a code for a specific amino acid
What is the correct amino acid sequence for the following DNA nucleotide sequence: GTAACAGAAGTACTTCCAGTACTA
What is the correct amino acid sequence for the following DNA nucleotide sequence: GTAACAGAAGTACTTCCAGTACTA
What is the most challenging part of understanding translation? The process through which the code of...
What is the most challenging part of understanding translation? The process through which the code of an mRNA molecule is translated into a sequence of amino acid residues is complicated. But what I would like you to tell me, and discuss with your classmates, precisely what it is about the process that you find hard to understand.
Which of the following is the term used to describe the process by which the amino...
Which of the following is the term used to describe the process by which the amino acid sequence in a protein molecule is constructed from information carried in messenger RNA? Choose one of the following: Replication Recombination Mutation Translation Transcription
A. Using the genetic code table, answer the following questions: Determine the sequence of amino acids...
A. Using the genetic code table, answer the following questions: Determine the sequence of amino acids from an mRNA sequence CCGUGU Determine the sequence of amino acids from a DNA template strand AATGTT List the start codon List the stop codons
12. The DNA remains in the nucleus when RNA is made. The process is properly known...
12. The DNA remains in the nucleus when RNA is made. The process is properly known as: A. Transcription B. Translation C. Conversation 15. A mutation in the DNA _________ results in a mistake in the amino acid sequence in the protein being built. A. Sometimes B. Never
Draw a peptide chain that includes up to 7 amino acids. Show their sequence by drawing...
Draw a peptide chain that includes up to 7 amino acids. Show their sequence by drawing the structure of each amino acid present in their chain, & calculate the net ionic charge on that peptide at a certain pH (any pH).
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT