Question

How could activating a transcription factor cause long-term cellular changes?

How could activating a transcription factor cause long-term cellular changes?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
1. What are the essential parts of a signaling pathway? 2. How could activating a transcription...
1. What are the essential parts of a signaling pathway? 2. How could activating a transcription factor cause long-term cellular changes? 3. What roles can phosphorylation play in protein function? 4. What is the enzymatic activity of a kinase and of a phosphatase?
Neuroscience: Synaptic Physiology: Describe the cellular and molecular mechanisms underlying Long Term Potentiation and Long Term...
Neuroscience: Synaptic Physiology: Describe the cellular and molecular mechanisms underlying Long Term Potentiation and Long Term Depression. Focus on trafficking of new AMPA receptors and phosphorylation of existing AMPA receptors. Also describe the stimulation pattern and the necessary cellular events that lead to the observed changes.
how do cytoxic drugs slow or stop the effect of neoplastic cellular changes? distinguish the sites...
how do cytoxic drugs slow or stop the effect of neoplastic cellular changes? distinguish the sites of action of the major drugs groups (make references to the cells cycle and mitosisis)? describe how gentic inhertiance of a mutated genes can lead to disease (include in the process of genetic transcription and translation
2) You have isolated a novel transcription factor. How will you determine the genes regulated by...
2) You have isolated a novel transcription factor. How will you determine the genes regulated by transcription factor in the whole genome?   
24. TBP is a protein subunit of the general transcription factor TFIID. What is the term...
24. TBP is a protein subunit of the general transcription factor TFIID. What is the term (acronym) used to name the other protein subunits found in TFIID? 25. The sequence below represents a 5’ region of a particular mRNA (assume that the t’s are u’s), containing a portion of the 5’UTR and the ORF: 5’…gacggactgttctatgactgcaaagatggaa… Taking into account the function of the start codon, what would by the amino acid sequence produced from the above portion of mRNA? 26. The...
How could catecholamines cause a decreased afterload?
How could catecholamines cause a decreased afterload?
Which of the following is not a factor in operating cash flow? A. Long-term debt B....
Which of the following is not a factor in operating cash flow? A. Long-term debt B. Depreciation expense C. Accounts Receivable D. Wages Payable
What are some positive and long-term results from the sustainable or eco-friendly changes?
What are some positive and long-term results from the sustainable or eco-friendly changes?
How would you decide whether a factor can be considered to be a 'cause' of something?
How would you decide whether a factor can be considered to be a 'cause' of something?
10.14 Since misperceptions theory shows how changes in AD cause changes in output, why is it...
10.14 Since misperceptions theory shows how changes in AD cause changes in output, why is it considered more of a Classical theory than a Keynesian theory? (30 words MAX)
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT