Question

along one strand of a DNA double helix is the nucleotide sequence GGCATAGGT. what is the...

along one strand of a DNA double helix is the nucleotide sequence GGCATAGGT. what is the sequence for the mRNA strand
Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Given DNA sequence: GGCATAGGT

Complementary sequence: CCGTATCCA

If the top strand acts as the template strand, mRNA sequence = CCGUAUCCA

If the bottom strand acts as the template strand, mRNA sequence = GGCAUAGGU

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will...
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will be amplified by PCR using short primers:      5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3'      Primers that could be used to amplify this entire DNA fragment are: A) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ B) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ C) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ D) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ E) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
What is the funcional of the enzyme DNA polymerase in replication? A) It reads the sequence...
What is the funcional of the enzyme DNA polymerase in replication? A) It reads the sequence of nucleotides on the parental strand of DNA and catalyzes the polymerization of a complementary daughter DNA strand. B) Its reads codond on a DNA molecule and catalyzes the polymerization of a complementary mRNA strand, C) It unwinds the double helix of DNA and separetes the two strand. D) It connects the short Okazaki fragments formed in the lagging strand. E) It carries the...
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
If one strand of DNA has a sequence of ATGCTGCGGGCT. What is the sequence of the...
If one strand of DNA has a sequence of ATGCTGCGGGCT. What is the sequence of the other strand.
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
Suppose there is a strand of DNA that has the following sequence on one strand: ATTCAGGC....
Suppose there is a strand of DNA that has the following sequence on one strand: ATTCAGGC. What is the sequence of bases on the matching strand?
1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions...
1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions proposed by Watson and Crick. 2. Compute for the actual length of the given DNA strand in micrometer. (1m = 10,000Ao) 3’ T T G G A T G A G G A C G C A C C C A C A G A A 5’ 5’ A A C C T A C T C C T G C G T G...
The nucleotide sequence of a DNA codon is CTA. A messenger RNA molecule with a complementary...
The nucleotide sequence of a DNA codon is CTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon? Select one: a. GAU b. GAT c. CTA d. CTA e. CUA
A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
Messelson and Stahl, determined that when DNA replication is completed, a)each new DNA double helix consists...
Messelson and Stahl, determined that when DNA replication is completed, a)each new DNA double helix consists of one old DNA strand and one new DNA strand b)each of the four DNA strands consists of some old strand parts and some new strand part one DNA double helix consists of two old strands and one DNA double helix consists of two new strands The Meselson-Stahl experiment was designed to answer which question? How does DNA replicate? What does the secondary structure...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT