How do you seal sequence 2 (from 5 ' end) to the 3' end of the sequence 1 in vitro condition ?Design a splint oligomer and write the all-possiblecontent(s) needed for reaction to occur. Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3'
Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'
DNA ligase is a specific type of enzyme, a ligase,that facilitates the joining of DNA strands together by catalyzing the formation of a phosphodiester bond. It plays a role in repairing single-strand breaks in duplex DNA in living organisms, but some forms may specifically repair double-strand breaks.
TGGTGACGGATAGGATGCAGAATTCC-3′ (forward), 5′-GGAATTCTGCATGCTATCCGTCACCA-3′ (reverse), 5′-GGGTCCGGATAGGATGCAGAATTCC-3′ (forward), 5′-GGAATTCTGCATCCTATCCGGACCC-3′ (reverse).
Conditioned media from cells was collected and centrifuged at 1,200 rpm for 5 min to remove cell debris. Cells were lysed by cell lysis reagent . After adding 17 μg/ml of diluted by Opti-MEM into samples, luciferase activity was immediately measured using a Wallac 1420. Statistical analysis was performed by one-way analysis of variance using Prism 5 for Mac OSX . Following ANOVA, the Bonferroni post hoc test was applied.
Get Answers For Free
Most questions answered within 1 hours.