Question

How do you seal sequence 2 (from 5 ' end) to the 3' end of the...

How do you seal sequence 2 (from 5 ' end) to the 3' end of the sequence 1 in vitro condition ?Design a splint oligomer and write the all-possiblecontent(s) needed for reaction to occur. Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3'

Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'

Homework Answers

Answer #1

DNA ligase is a specific type of enzyme, a ligase,that facilitates the joining of DNA strands together by catalyzing the formation of a phosphodiester bond. It plays a role in repairing single-strand breaks in duplex DNA in living organisms, but some forms may specifically repair double-strand breaks.

TGGTGACGGATAGGATGCAGAATTCC-3′ (forward), 5′-GGAATTCTGCATGCTATCCGTCACCA-3′ (reverse), 5′-GGGTCCGGATAGGATGCAGAATTCC-3′ (forward), 5′-GGAATTCTGCATCCTATCCGGACCC-3′ (reverse).

Conditioned media from cells was collected and centrifuged at 1,200 rpm for 5 min to remove cell debris. Cells were lysed by cell lysis reagent . After adding 17 μg/ml of diluted by Opti-MEM into samples, luciferase activity was immediately measured using a Wallac 1420. Statistical analysis was performed by one-way analysis of variance using Prism 5 for Mac OSX . Following ANOVA, the Bonferroni post hoc test was applied.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
For the sequence 8x + 4, 7x + 3, 6x + 2, 5x +1, ... ,...
For the sequence 8x + 4, 7x + 3, 6x + 2, 5x +1, ... , a. Identify the next 3 terms. b. Is the sequence arithmetic or geometric? How do you know? c. Find the explicit and recursive formulae for this sequence. d. Write out the sum formula for the first 20 terms and evaluate. e. Write your process to part (d) in Sigma Notation.
Write and upload a MATLAB script to do the following. Compute the sequence S(n+1) = (2...
Write and upload a MATLAB script to do the following. Compute the sequence S(n+1) = (2 – K) S(n) – S(n-1) ;   Assume S(1) = 0, S(2) = 1; (a)    Case 1, Assume K = 1 (b)    Case 2, Assume K = 2 (c)     Case 3, Assume K = 4 Plot all of these on the same plot, for N = 1 to 20
Answer all questions in sequence, using the oligopeptide. 5’-AACGATGCCATCAGAGCCCAGGACGTGATTTAA-3’ 3’-TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT-5’ 1) Which is the template strand?...
Answer all questions in sequence, using the oligopeptide. 5’-AACGATGCCATCAGAGCCCAGGACGTGATTTAA-3’ 3’-TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT-5’ 1) Which is the template strand? 2) Write each functional strand and underline ea functional codon. Make sure to write 5’/3’ position. 3) Using one theee letter abrev for amino acid, what is the residue sequence? Make sure to label the ends.
12. You have a short piece of DNA. One strand has the following sequence: 5’ AGCTACTCCTAA...
12. You have a short piece of DNA. One strand has the following sequence: 5’ AGCTACTCCTAA 3’. a. Please write down sequence of the other strand, starting with the 5’ end. (0.2 pt) b. If these two strand wind together as a B form DNA, how long do you expect this DNA to be? (0.2 pt) c. How many hydrogen bonds are there to stabilize the structure of this DNA? (0.2 pt) d. Besides hydrogen bonds, what other forces stabilize...
In mathematical terms, the sequence Fn of Fibonacci numbers is 0, 1, 1, 2, 3, 5,...
In mathematical terms, the sequence Fn of Fibonacci numbers is 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, …….. Write a function int fib(int n) that returns Fn. For example, if n = 0, then fib() should return 0, PROGRAM: C
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
1 .Answer the following questions about the arithmetic sequence 2, 5, 8, 11, .... . Find...
1 .Answer the following questions about the arithmetic sequence 2, 5, 8, 11, .... . Find n if the series 2 + 5 + 8 + 11 + ⋯ + 119 = 2420. 2. Answer the following questions about the geometric sequence 3, 12, 48, 192. Which term in the sequence is 12288? 3. Find the sum of the series 106 + 103 + 100 + 97 + ⋯ − 41. 4.Find S7 and S∞ for the series 6 +...
No longer needed solved Which reactant is being oxidized in the following reaction? 2 Al +...
No longer needed solved Which reactant is being oxidized in the following reaction? 2 Al + 3 Sn2+ --> 2 Al3+ + 3 Sn Just give the reactant. No need to include the coefficient if there is one. Indicate what is wrong with the statement given and write how you would fix it to be correct. In order for an oxidation reaction to occur, oxygen must be lost by all reactants.
Answer all 3 three questions. 1.How do you define health? How do you define Illness? 2....
Answer all 3 three questions. 1.How do you define health? How do you define Illness? 2. What makes some people healthy and others unhealthy? 3. How can we create a society in which everyone has a chance to live long healthy lives?
IN C++ The Catalan numbers are an integer sequence Cn that appears in tree-enumeration problems. The...
IN C++ The Catalan numbers are an integer sequence Cn that appears in tree-enumeration problems. The first Catalan numbers for n = 1, 2, 3, ... are 1, 2, 5, 14, 42, 132, .... A formula generating Cn is: Cn=(1÷(n+1))=(2n)!÷(n+1)!n! Design two programs that communicate with shared memory using the Win32 API as outlined in Section 8.7.2. The producer process will generate the Catalan sequence and write it to a shared memory object. The consumer process will then read and...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT