Question

5' AGTTGTATAGAAAACTGCGAA 3' What DNA sequence (give as 5' to 3') would be formed by replicating the sequence shown above? What RNA sequence (give as 5' to 3') would be formed by transcribing the sequence formed in part 1? What protein sequence (give as N to C terminus) would be formed by translating the sequence formed in part 2?

Answer 1

part 1st:: in DNA replication it happens in 5' to 3' direction, and A gives T and C gives G ( vice versa )

so the sequence after replication in 5' to 3' direction is 5' TTCGCAGTTTTCTATACAACT 3'

part 2nd: Transcription also happens in 5' to 3' direction and T gives A , A gives U, C gives G

so the sequence after transcription in 5' to 3' direction is 5' AGUUGUAUAGAAAACUGCGAA 3'

so protien coded by these codon will be in N to C terminus direction N-ser-cys-ile-C

Since GAA is a stop codon then translation will stop here.

( image for steps )