Question

If there are two fragments of RNA say strand 1 and strand 2 to be "stitched"...

If there are two fragments of RNA say strand 1 and strand 2 to be "stitched" together (both sequence 1 and 2 going in 5' to 3' direction),

for example, strand 1 is 5' AAUGACCAC 3' and strand 2 is 5' AAGCUCGCGGCCGUACAUCUU 3', would the stitching be done as

strand 1+strand 2 - 5' AAUGACCACAAGCUCGCGGCCGUACAUCUU 3'

or

strand 2+strand 1? - 5' AAGCUCGCGGCCGUACAUCUUAAUGACCAC 3'

I understand RNA is always made in 5' to 3' direction but both seem to be a valid 5' to 3' growth. The question asks to stitch the first 9 nucleotides of a sequence (strand 1) to sequence 2.

Please explain as which of the two is the right way to stitch and why.

Homework Answers

Answer #1

According to the information, stitching or sealing of the two DNA strands is required to be done. Here, it must be carefully noted that whatever is the order of stitching the strands, the RNA strand containing an AUG codin earliest towards the 5' side must be taken as the reference. Thisbis because post-transcription, the RNA would be translated and the translational machinery identifies the RNA strand carrying a start codon or AUG as thr primary site.

Since the sequence 1 contains this start codon earlier than the sequence 2, the order of stitching must be 1+2, so that appropriate translation might take place.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
QUESTION 1 * Compared to the leading strand, the lagging strand requires ________ primers.?? A. more...
QUESTION 1 * Compared to the leading strand, the lagging strand requires ________ primers.?? A. more B. the same number of C. less QUESTION 2 * Which enzyme synthesizes the majority of the DNA polymer for both the leading and lagging strands??? A. DNA polymerase I B. primase C. DNA polymerase III D. helicase QUESTION 3 * For each origin of replication, how many DNA polymerase III enzymes are needed??? A. 1 B. 8 C. 4 D. 2 QUESTION 4...
1. The strand that has stopped following the splitting of the original strands is called the...
1. The strand that has stopped following the splitting of the original strands is called the ____________ strand. 2. The strand moving away from the splitting of the original strands is called the _______________ strand. 3. The strand from #1 is done in fragments. These are called __________.   4. How are these fragments connected together?
1. As the RNA polymerase is synthesizing new RNA, it uses one strand of the DNA...
1. As the RNA polymerase is synthesizing new RNA, it uses one strand of the DNA as a template and it adds a new nucleotide to which end of the growing RNA strand? As it moves along the DNA template, which direction is the polymerase moving? 2. In eukaryotes, the genomic DNA is packaged with proteins called histones. What is the term for the combination of DNA + histones? 3. In eukaryotes, when the initial RNA is transcribed, is it...
A bomb at rest explodes into three fragments. Two of these fragments with mass m1 =...
A bomb at rest explodes into three fragments. Two of these fragments with mass m1 = 2 kg, and m2 = 1 kg respectively, travel in left direction; the other fragment with mass m3 = 3 kg travels in opposite direction. If the velocities of fragments 1 and 2 are v1 = 5 m/s and v2 = 2 m/s respectively, find the velocity of fragment 3.
1.What is the role of telomerase in DNA replication? a) join Okazaki fragments together b) synthesize...
1.What is the role of telomerase in DNA replication? a) join Okazaki fragments together b) synthesize RNA nucleotides to make a primer c) catalyze the lengthening of the ends of linear chromosomes d) are part of the initiation of replication at the origin of replication 2. RNA polymerase for mRNA transcription and DNA polymerase in replication differ in that a) RNA polymerase uses RNA as a template, and DNA polymerase uses a DNA template. b) RNA polymerase does not need...
1. This type of bond is used to link monomers of nucleic acids together Select one:...
1. This type of bond is used to link monomers of nucleic acids together Select one: Peptide Ionic Hydrogen Glycosidic Phosphodiester 2. Which is true of DNA polymerase? Select one: One of its functions is to uncoil the double stranded DNA It hooks nucleotides together in a 5' to 3' direction It does not recognize RNA primers, thus controlling replication It hooks nucelotides together in any direction It does not make Okazaki fragments 3. Chargaff's contribution to the identification of...
1.What are the building blocks of nucleic acids? 2.What are the 3 components of these building...
1.What are the building blocks of nucleic acids? 2.What are the 3 components of these building blocks ? 3.How is RNA different from DNA? Give three specific reasons. a._______________________________________________ b._______________________________________________ c._______________________________________________ 4.What are the three types of RNA found in a cell, what is the function of each and are these translated? RNA Function Translated? a. b. c. 5.What is a codon? a. Anticodon? Each of the following questions asks you to work out a sequence of nucleotide bases. When...
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with...
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with which parts of the DNA does the protein primarily interact? A. the phosphate and deoxyribose groups in the DNA backbone B. the phosphate and deoxyribose groups in the DNA backbone, and hydrophobic interactions with the nucleotide bases C. nucleotide bases within the major grooves of the DNA D. nucleotide bases within the major and minor grooves of the DNA E. none of the above...
1) At replication fork, the DNA segment is kept as single strand DNA mainly due to...
1) At replication fork, the DNA segment is kept as single strand DNA mainly due to A) DAN Gyrase B) Single-strand binding proteins C) Helicase 2) The major reason that causes basal transcription is: A) there are transcription inhibitors B) only core promoter is involved in the transcription C) at the beginning of transcription 3. In bacteria, the RNA transcripts are made starting at: A) -35 site B) 0 site C) +1 site 4. Which of the following regions/sites of...
Q1 : put the following of protein synthesis transcription steps in the correct order A- the...
Q1 : put the following of protein synthesis transcription steps in the correct order A- the RNA-pol stops transcribed when reaching a repetitive sequences of T nucleotides B- the 3"segments of the nascent RNA hybridizes with the DNA template , and its 5'end extends out the transcription C- after DNA transcription passes , the two DNA strands reform D- RNA-pol start move on the DNA template melting and unwinding the double helix F- the transcript RNA strand is released G-...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT