Question

30. Which TWO modifications of heterogenous nuclear RNA is important for the stability of the transcription and for its translation?

31. Below is a sequence of a heterogenous nuclear RNA with exons shaded grey and nucleotides that are important for splicing indicated in bold.

...cacccggctcccgcttcacctggggcacagtgcaggtggtcacaggccaagcgggcacgcccactgtgccccccgaccccagcccacagg

   ctcctgtccctgcccactcagcttcaaggcct…

Which cis-acting elements come into close proximity to form the lariat during splicing?

Extra credit: What is the protein that is translated from the mRNA indicated in questions 25 and 26 and what is its general function (hint: you will need to use one of the algorithms found on the NCBI website)?

Answer 1

30. The two modifications are processing and splicing:

Heteronuclear RNA Processing: 5' Processing involves the addition of 7-methylguanosine (m⁷G) to 5'-end of the heteronuclear-RNA. The process is called capping. 3' Processing involves the addition of adenine residues (~250) after cleavage at 3'-end. The process is called polyadenylation.

Alternate Splicing: It is the process in which non-coding regions called introns removed from the transcript RNA and coding regions called exons are reconnected to form a single molecule.

31. Uridine branch acceptor is the cis-acting element which comes into close proximity to form the lariat during splicing as the nucleotides highlighted in bold are U2 type intronic sites.