Question

Suppose the DNA template sequence 5'-GGC GAC CCC CAC-3’ was replicated by a DNA polymerase. Write...

Suppose the DNA template sequence 5'-GGC GAC CCC CAC-3’ was replicated by a DNA polymerase. Write the resulting replication product sequence (in proper 5’ -> 3’ orientation!). Also right the resulting replication product sequence if the DNA template sequence 5'-GAC GAA CAC CCC-3’ was transcribed by a RNA polymerase.

Homework Answers

Answer #1

As DNA synthesis only takes place at 3' end hence the 5' end is synthesized on 3' of template strand. Resultant replicatrep product will be -

Templetete 3'-CAC CCC CAG CGG-5'

Product 5'-GTG GGG GTC GCC-3'

RNA polymerases synthesize RNA not DNA

RNA sequence - 5'-GGG GUG UUC GUC-3'

As RNA bear group Uracil and not thymine hence U is complimentry present in mRNA in place of Thymine.

Retroviruses may give complimecompl DNA from RNA with the help of enzyme Reverse Transcriptase and product will be-

5'-GAC GAA CAC CCC-3'

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Telomere replication is possible due to: A DNA overhang on the 5’ and 3’ ends that...
Telomere replication is possible due to: A DNA overhang on the 5’ and 3’ ends that acts as a template for the DNA polymerase Their circular nature allows roundabout synthesis by the replication fork An RNA template within telomerase which allows synthesis past the 5’ and 3’ overhangs. Telomeres are not replicated A ribozyme polymerizes the nascent DNA strands.
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
DNA sequence. 5’-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT-3’ “Transcribe” and form an RNA transcript based on the DNA sequence. Illustrate the...
DNA sequence. 5’-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT-3’ “Transcribe” and form an RNA transcript based on the DNA sequence. Illustrate the amino acid sequence of the resulting polypeptide using the genetic code. *Please follow proper directionality of both the RNA strand and the polypeptide. Indicate clearly and label correctly the ends of the molecules mentioned. What is/are the characteristic feature/s of the resulting polypeptide based on the viral DNA sequence given?
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the...
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the start codon, and determine the complete amino acid sequence that would be translated. Be specific about the amino-terminus and carboxyl-terminus.
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region...
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region (assume there is no operator) and transcribe the DNA to the right of the promoter. Once you’ve transcribed the DNA into mRNA, find the start codon and translate the sequence into the correct amino acids to create a polypeptide. 3’-AATATTTATTATATAACCCGGCATACGTTCGGACGTCCCATATAGACTCCATTCGACTT-5’
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
If a strand of DNA of sequence 5’-AATAGCGCGGTATTC-3’ is replicated, which of the following accurately represents...
If a strand of DNA of sequence 5’-AATAGCGCGGTATTC-3’ is replicated, which of the following accurately represents the newly synthesized DNA strand?
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
*A DNA template sequence is 3’ ATG 5’. The complimentary mRNA codon sequence is: A 5’...
*A DNA template sequence is 3’ ATG 5’. The complimentary mRNA codon sequence is: A 5’ TAC 3’      B 5’ UAC 3’      C 3’ TAC 5’      D 3’ UAC 5’
Given the DNA template strand 3' GTCGAACGT 5', write the amino acid sequence in the N-terminal...
Given the DNA template strand 3' GTCGAACGT 5', write the amino acid sequence in the N-terminal to the C-terminal direction. Use the three-letter amino acid abbreviations.