Question

What inactivates an active G-protein alpha subunit?

What inactivates an active G-protein alpha subunit?

Homework Answers

Answer #1

G proteins are membrane-associated, heterotrimeric proteins composed of three subunits such as alpha, beta, and gamma. The activated receptor facilitates the exchange of bound GDP for GTP on the G protein alpha subunit. The primary function of GPCRs in activating G proteins is to catalyze an exchange of GTP for GDP. This is the temporary switch because G proteins contain an inherent GTPase activity that is responsible to hydrolyze the bound GTP and converts the G protein back into the GDP-bound. That is the inactive state of G-protein alpha subunit.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
When a hormone such as epinephrine binds to a GTP-bound receptor, the G protein alpha subunit...
When a hormone such as epinephrine binds to a GTP-bound receptor, the G protein alpha subunit leaves to activate adenylyl Cyclase. When the alpha subunit re-associates with the beta/gamma subunits of the G protein, is the hormone still attached to the GTP-bound receptor? When exactly does the hormone leave the receptor — is it when the G protein is GTP-activated or when the G protein is reassembled back into alpha/beta/gamma?
The kcat for the GTP hydrolysis by the G? subunit of a heterotrimeric G protein is...
The kcat for the GTP hydrolysis by the G? subunit of a heterotrimeric G protein is 0.026 /min How long will a single molecule of G? be active?
the events below are what happens when a G-protein coupled receptor is activated. Place the events...
the events below are what happens when a G-protein coupled receptor is activated. Place the events in the correct order. -Conformational shift in the alpha subunit of the G protein -Increase in the affinity of the receptor for a G protein on the cytoplasmic surface of the membrane. -G protein binds to activated receptor forming a receptor-G protein complex -Binding of a hormone to a G-protein couple receptor -Dissociation of the Ga subunit and the GBy complex -Release of GDP...
If there is no ATP protein synthesis can’t start                protein synthesis will stop at the...
If there is no ATP protein synthesis can’t start                protein synthesis will stop at the middle elongation step will be diminished termination step can’t proceed    If there are no chaperones the ribosome can’t make the protein             the large ribosomal subunit can’t detach the protein still will be active the protein won’t make the native state            The large subunit of the ribosome binds to the small subunit after the aminoacyl-t-RNA has joined                                         before the aminoacyl-t-RNA has joined...
The Galpha subunit is active when: A. it is bound to a molecule of GTP. B....
The Galpha subunit is active when: A. it is bound to a molecule of GTP. B. it is bound to a molecule of GDP C. it is bound to a molecule of cAMP D. it is bound to a molecule of cGMP E. all of the above are correct. In the Pyruvate Dehydrogenase complex, the acetyl unit is passed to the coA directly from _________. A. biotin B. TPP C. pyruvate D. FAD E. lipoyllysine
Activation of signal transduction pathways controlled by G-protein coupled Receptors (GPCRs) has been implicated in many...
Activation of signal transduction pathways controlled by G-protein coupled Receptors (GPCRs) has been implicated in many forms of cancer. One part of the pathway that seems to be particularly sensitive to mutation are trimeric G proteins. a. Inactivation of the Ga subunit can occur 100 times faster in the presence of a GAP (GTPase Activating Protein). Explain the function of a GAP and why it will deactivate the Ga subunit of a trimeric G protein being sure to account for...
24. TBP is a protein subunit of the general transcription factor TFIID. What is the term...
24. TBP is a protein subunit of the general transcription factor TFIID. What is the term (acronym) used to name the other protein subunits found in TFIID? 25. The sequence below represents a 5’ region of a particular mRNA (assume that the t’s are u’s), containing a portion of the 5’UTR and the ORF: 5’…gacggactgttctatgactgcaaagatggaa… Taking into account the function of the start codon, what would by the amino acid sequence produced from the above portion of mRNA? 26. The...
Where is the G-protein complex when a ligand is not bound to its receptor? The beta...
Where is the G-protein complex when a ligand is not bound to its receptor? The beta and gamma subunits are attached to the inner surface of the receptor. The three subunits are together but not attached to the inner surface of the receptor. The alpha subunit is attached to the inner surface of the receptor. Which of the following does NOT affect the rate of diffusion through a membrane? membrane pore size solute size solute concentration solute kinetic energy The...
Protein A is a transcriptional regulatory protein for operon alpha. Gene expression of the operon is...
Protein A is a transcriptional regulatory protein for operon alpha. Gene expression of the operon is unregulated in the presence of co-factor molecule Q. If A is deleted, gene expression on the operon alpha is constitutive. What type of regulation is this and what type of regulatory/co-factor are A and Q?
determine the subunit composition of a protein from the following information: Molecular mass by gel filtration:...
determine the subunit composition of a protein from the following information: Molecular mass by gel filtration: 250 kDa Molecular mass by SDS-PAGE(w/oBME): 55kDa, 50kDa,45kDa Molecular mass by SDS (wBME):50kDa,45kDa,30kDa,25kDa