Question

If one strand of DNA has a sequence of ATGCTGCGGGCT. What is the sequence of the...

If one strand of DNA has a sequence of ATGCTGCGGGCT. What is the sequence of the other strand.

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Ans:

If one strand of DNA has a sequence of ATGCTGCGGGCT. The sequence of the other strand is: TACGACGCCCGA.

Explanation:

- The double helix of DNA contains two polynucleotide strands wound around each other.

- Two strands of DNA are complementary to each other.

- Adenine base pair with thymine while guanine base pair with cytosine.

- Strands interact by hydrogen bonds between complementary base pairs.

- Guanine forms three hydrogen bonds with cytosine.

- Adenine forms two hydrogen bonds with thymine.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Suppose there is a strand of DNA that has the following sequence on one strand: ATTCAGGC....
Suppose there is a strand of DNA that has the following sequence on one strand: ATTCAGGC. What is the sequence of bases on the matching strand?
one strand of a DNA molecules has the sequence of 5' ATGCAGA 3' the complementary strand...
one strand of a DNA molecules has the sequence of 5' ATGCAGA 3' the complementary strand would have the sequence is 3'TACGTCT5' ????
along one strand of a DNA double helix is the nucleotide sequence GGCATAGGT. what is the...
along one strand of a DNA double helix is the nucleotide sequence GGCATAGGT. what is the sequence for the mRNA strand
12. You have a short piece of DNA. One strand has the following sequence: 5’ AGCTACTCCTAA...
12. You have a short piece of DNA. One strand has the following sequence: 5’ AGCTACTCCTAA 3’. a. Please write down sequence of the other strand, starting with the 5’ end. (0.2 pt) b. If these two strand wind together as a B form DNA, how long do you expect this DNA to be? (0.2 pt) c. How many hydrogen bonds are there to stabilize the structure of this DNA? (0.2 pt) d. Besides hydrogen bonds, what other forces stabilize...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3'...
5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3' ends)? b) underline the pyrimidines in the given sequence c) what other components are also part of a DNA double strand molecules but are NOT indicated in this strand?
A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
if one strand of a DNA molecule has the sequence of bases 5'ATTGCA3', mRNA which transcribes...
if one strand of a DNA molecule has the sequence of bases 5'ATTGCA3', mRNA which transcribes from this strand would have the sequence * a..5'..UAACGU..3'. b..3'..TAACGT..5'. c..5..'TAACGT..3'. d..5'..AUUGCA..3'. how the ans. is D? i thought it is A
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT