Question

A point mutation occurs in the middle of the coding sequence for a gene. Which types...

A point mutation occurs in the middle of the coding sequence for a gene. Which types of mutations-silent, missense, nonsenese, and frameshift- would most likely dirupt protein function and which would be most likely?

Homework Answers

Answer #1

Silent mutation is change in mutation in third position of codon such that amino acid does not change. So, it doesn't affect the protein.

Missemse mutation changes one amino acid but that won't disrupt the protein function.

Nonsense mutation changes amino acid codon into stop codon and protein is not made. So, this will definitely disrupt the protein function and structure.

Frameshift mutation is insertion or deletion of nucleotide in gene such that the whole codon frame is changed and different protein is made. This will also disrupt the protein function.

Nonsense mutation would be most likely to disrupt the protein function because of the stop codon that makes truncated protein.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A deletion of seven nucleotides occurs in the promoter sequence of a gene. Which is the...
A deletion of seven nucleotides occurs in the promoter sequence of a gene. Which is the most likely result of this change? a missense mutation a regulatory mutation a silent mutation a nonsense mutation a frameshift mutation
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
Suppose that a mutation occurs in an intron of a gene encoding a protein, changing the...
Suppose that a mutation occurs in an intron of a gene encoding a protein, changing the sequence of one nucleotide within the intron. What would be the most likely effect of this mutation on the amino acid sequence of that protein? Briefly explain your answer
A nucleotide substitution within the protein coding sequence of a wild type gene results in a...
A nucleotide substitution within the protein coding sequence of a wild type gene results in a truncated,, completely nonfunctional proteins. This mutation can be characterized as all of the following EXCEPT: forward mutation frameshift amorphic nonsense
Which of the following is the most likely effect of a mutation in the gene coding...
Which of the following is the most likely effect of a mutation in the gene coding for a DNA repair enzyme? - The cell containing the mutation will divide more frequently because the cell cycle checkpoints will not function properly. - Mutations will accumulate more quickly because the cell will not be able to fix errors in replication. - The mutated gene will not be transcribed because RNA polymerase cannot transcribe mutated DNA. - The cell will immediately undergo apoptosis...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
What is the most likely type of mutation to cause an amorphic allele in a protein-coding...
What is the most likely type of mutation to cause an amorphic allele in a protein-coding gene that alters the protein’s structure? Clearly explain your reasoning. (For this question, assume that X = 3, that the frameshift is caused by a single nucleotide deletion, and that the given mutation would occur at the same location in the gene.)
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What...
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What type of mutation is this? Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3 a missense mutation a silent mutation an exonic mutation a frameshift mutation a nonsense mutation
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´