Question

1. A.) What does the Product of the RT step represent relative to gene expression in...

1.

A.) What does the Product of the RT step represent relative to gene expression in any cell or tissue?

B.) Explain the function of the different components in the RT and PCR experiments.

Homework Answers

Answer #1

A. RT step = Reverse Transcription step.

It involves the conversion of mRNA to cDNA. The amount of a particular cDNA produced depends upon the number of the corresponding mRNA molecules present in the sample. So, if a gene is highly expressed in a cell, its mRNA and cDNA copy number would be high after the RT reaction.

If a gene is expressed at a very low level in a cell, its mRNA and cDNA copy number would be low after the RT reaction.

B. RT reaction components:

i. Reverse transcriptase = Enzyme that converts RNA to DNA

ii. dNTPs = Substrates for DNA synthesis

iii. Oligo dT = Binds to the poly-A tail of the mRNA and serves as a primer.

iv. Buffer = Provides optimum reaction conditions (pH and ions)

v. RNase inhibitor = Prevents the degradation of RNA in the sample.

vi. Water

PCR reaction components:

i. Template DNA

ii. dNTPs

iii. Taq

iv. Buffer

v. Primers

vi. Water

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
RT-PCR involves a series of two distinct enzymatic reactions. For the RT step what is the...
RT-PCR involves a series of two distinct enzymatic reactions. For the RT step what is the enzyme and what is the substrate? For the PCR step, what is the enzyme and what is the substrate? 3. Is the product of these experiments single or double stranded? 4. How will we use gel electrophoresis in these experiments?
Part 1: Click on the box that says “Expression.” You are presented with a gene that...
Part 1: Click on the box that says “Expression.” You are presented with a gene that contains a regulatory region and a transcribed region. Your goal is to produce 3 proteins from each of three genes. The proteins are indicated by the shapes in the box at the top right. You need to successfully transcribe each gene, and then translate the message from the gene into a protein using your knowledge of how these processes work. GENE 1 Questions What...
Control of Gene Expression 1. How is it possible that individual cells of a multicellular organisms,...
Control of Gene Expression 1. How is it possible that individual cells of a multicellular organisms, which contain all the same DNA, can be so different from one another? 2. What are housekeeping proteins? What are their roles in the cell? 3. Describe the ways in which cells control gene expression. 4. How does control of transcription in prokaryotes and eukaryotes differ? 5. What is the role of operons in the prokaryotic genome? 6. A rare mutation occurs in bacteria...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).
You isolate cells from the brain of a mouse, and work to characterize them. In your...
You isolate cells from the brain of a mouse, and work to characterize them. In your first experiments you grow your cells in a petri dish, and add various signals to the petri dish and determine how the cells respond. You get the following information. Assume there are no other genes or signals beyond what is mentioned. Hint: sometimes it helps to sketch the signal pathways first, and then answer the questions. But use whatever strategy works for you! Signal...
1. . It has been stated that “species form a boundary for gene flow”. What does...
1. . It has been stated that “species form a boundary for gene flow”. What does this mean? Are there exceptions to this statement? Explain. 2. Your text points out that gene flow between some prokaryote species can lead to speciation, while gene flow between eukaryote populations prevents speciation. How does this work? Explain.
Question 3: Diagnose a novel set of signal transduction pathways (8 pts) You isolate cells from...
Question 3: Diagnose a novel set of signal transduction pathways (8 pts) You isolate cells from the brain of a mouse, and work to characterize them. In your first experiments you grow your cells in a petri dish, and add various signals to the petri dish and determine how the cells respond. You get the following information. Assume there are no other genes or signals beyond what is mentioned. Hint: sometimes it helps to sketch the signal pathways first, and...
1. Which step is first in viewing all the conditional rules you have applied to a...
1. Which step is first in viewing all the conditional rules you have applied to a Pivot Table? Select an answer: Open a new worksheet, then click any cell. Click any Totals or Subtotals cell within the Pivot Table. Click any cell on the worksheet outside of the Pivot Table. Click any cell on the within the Pivot Table. 2. Why would you use Data Bars with a Pivot Table? Select an answer: to horizontally display the relative magnitude of...
When calculating allele frequencies, what does the chi-square statistic tell us? a. whether gene frequencies in...
When calculating allele frequencies, what does the chi-square statistic tell us? a. whether gene frequencies in a population differ from random expectations and change through time b. relative fitness of different alleles in a population c. difference in mean fitness between two populations d. All answers are correct.
What does the level of significance represent in a test of hypothesis? Please give 1 example...
What does the level of significance represent in a test of hypothesis? Please give 1 example and explain thoroughly
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT