Question

Indicate if you think the RNA sequence below could be part of a riboswitch mechanism and...

Indicate if you think the RNA sequence below could be part of a riboswitch mechanism and explain why.
Strand 1: AUGCCAUAGCUUCGAUGGGCAUCGAAGCUAUGGCGAGAUUUCGAAGCUA

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

I try to learn start with the basic concept and finally mechanism and then you will automatically understand..

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Explain how riboswitches function. (6) 6.2 Indicate if you think the RNA sequence below could be...
Explain how riboswitches function. (6) 6.2 Indicate if you think the RNA sequence below could be part of a riboswitch mechanism and explain why. Strand 1: AUGCCAUAGCUUCGAUGGGCAUCGAAGCUAUGGCGAGAUUUCGAAGCUA
DNA sequence. 5’-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT-3’ “Transcribe” and form an RNA transcript based on the DNA sequence. Illustrate the...
DNA sequence. 5’-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT-3’ “Transcribe” and form an RNA transcript based on the DNA sequence. Illustrate the amino acid sequence of the resulting polypeptide using the genetic code. *Please follow proper directionality of both the RNA strand and the polypeptide. Indicate clearly and label correctly the ends of the molecules mentioned. What is/are the characteristic feature/s of the resulting polypeptide based on the viral DNA sequence given?
If there are two fragments of RNA say strand 1 and strand 2 to be "stitched"...
If there are two fragments of RNA say strand 1 and strand 2 to be "stitched" together (both sequence 1 and 2 going in 5' to 3' direction), for example, strand 1 is 5' AAUGACCAC 3' and strand 2 is 5' AAGCUCGCGGCCGUACAUCUU 3', would the stitching be done as strand 1+strand 2 - 5' AAUGACCACAAGCUCGCGGCCGUACAUCUU 3' or strand 2+strand 1? - 5' AAGCUCGCGGCCGUACAUCUUAAUGACCAC 3' I understand RNA is always made in 5' to 3' direction but both seem to be...
1. Use the numbers in the choices below to indicate where in the schematic diagram of...
1. Use the numbers in the choices below to indicate where in the schematic diagram of a eukaryotic cell those processes take place. Write each number 1-5 next to “nucleus,” “ribosomes,” or “endoplasmic reticulum.” transcription translation RNA splicing polyadenylation RNA capping 2. (True / False) A linear chromosome can have multiple origins of replication. 3. Part of the RNA sequence below encodes the N-terminal region of a protein, but not all of the nucleotides shown are translated into protein. Given...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes the 3' untranslated sequence and the first part of the translated sequence. The promoter for this gene is TATAT. Transcription begins with the third base after the promoter. For each answer portion, in your response, write each one starting on a new line and please write A, B, C, etc. as you go. A)   Transcribe and B). translate this sequence into its final peptide...
5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3'...
5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3' ends)? b) underline the pyrimidines in the given sequence c) what other components are also part of a DNA double strand molecules but are NOT indicated in this strand?
You have discovered a new protein. As part of your analysis you determine its sequence. Within...
You have discovered a new protein. As part of your analysis you determine its sequence. Within the sequence you find regional stretches that are rich in aliphatic and non polar aromatic amino acids. What could these regions indicate about the location of this part of the protein within the cell? Why?
What test could you perform using RNA to test whether the genome is positive or negative?...
What test could you perform using RNA to test whether the genome is positive or negative? What results would you expect if virus was positive strand? What resultst would you expect if the virus was negative stranded?
     The article states that having an error-prone RNA-dependent RNA polymerase could promote generation of a lot...
     The article states that having an error-prone RNA-dependent RNA polymerase could promote generation of a lot of genetic variation and lead to species jumps. Can you explain why?
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a)...
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a) Find the protein-coding sequence and provide the amino acid sequence of the encoded protein (b) Which amino acid is at the C-terminus of this peptide?
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT