Question

The following is the sequence of bases in the sense strand of a DNA segment and contains the beginning of a gene.

DNA 3? A T A T T A C C A G G C A T G G A C C C C C G G G 5?

Based on this sequence, write the sequence of the anti-sense DNA strand and the mRNA. Label the 5? and 3? ends in your predicted sequences. The start codon in this organism is AUG. Indicate where the start codon is in your sequence. Why is the start codon important? Why does there have to be a specific start codon?

Answer 1

The answer is as follows:

ANTISENSE DNA STRAND - 5' TATAATGGTCCGTACCTGGGGGCCC 3'

mRNA STRAND - 3' AUAUUACCAGGC*AUG*GACCCCCGGG 5' ( Start codon is shown between * )

Start codon is important in a sequence because this is how a ribosome would know where to start synthesizing the aminoacid chain from. There can be multiple start codons in a gene all together but the first one in the gene is detected by ribosome and the first stop codon is where it dissociate from the sequence to finish translation.

Feel free to leave a comment down below for any furhter query. Good rating would be appretiated if you find my answer helpful. Thank you.