Question

If a mutation occurred in the sequence of instructions responsible for reproduction what do you predict...

If a mutation occurred in the sequence of instructions responsible for reproduction what do you predict would happen to the mutated offspring’s ability to reproduce?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

The type of mutation decide the offspring's reproductive ability. There may be silent Mutation, in which there is alteration in DNA sequences but donot affect the gene product. Offspring's are able to reproduce in these type of mutation.

Some mutation may affect the offspring's reproductive success because this may cause low sperm count due to decrease in testosterone levels or some might not get matured.

Disruption in normal functioning of NR5A1, demusculinizes animals. Mutation can cause infertility because of underdevelopment of gonads and also affect puberty.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´
Examine the following series of words and identify what kind of mutation occurred in each, starting...
Examine the following series of words and identify what kind of mutation occurred in each, starting with the first word in the non-mutated form: BEAST (non-mutated form) FEAST BREAST BEST BEATS
A mutation has occurred in the DNA binding sequence for p53. The binding site is Pu-Pu-Pu-C-A/t-T/a-G...
A mutation has occurred in the DNA binding sequence for p53. The binding site is Pu-Pu-Pu-C-A/t-T/a-G Py-Py-Py; and is converted to Pu-Pu-Pu-T-A/t-T-A/t-T/a-G Py-Py-Pu in the promoter of the Mdm2 gene. What base would be methylated? What would be the effect of such a mutation on methylation ? What could be the effect of such a mutation on p53 binding? And, why? How would the expression of Mdm2 be affected ?
Do certain sequence contexts show a higher rate of de novo somatic mutation? Which sequence contexts,...
Do certain sequence contexts show a higher rate of de novo somatic mutation? Which sequence contexts, and what is the basis for this difference?
3. For what kind of sequence is the mutation rate and the neutral mutation rate likely...
3. For what kind of sequence is the mutation rate and the neutral mutation rate likely to be identical? a) exons b) 3’-­UTRs c) introns d) pseudogenes e) 5’-­flanking regions 4. In a particular population an investigator measures DNA sequence variation for the X chromosome, the autosomes, the Y-chromosomes, and the mitochondrial genome. For sites free of natural selection and assuming the same mutation rate across chromosomes, what is the expected rank order of neutral heterozygosity these chromosomes? Why? 5....
What do you predict would happen if the foramen ovale and/or ductus arteriosus did not completely...
What do you predict would happen if the foramen ovale and/or ductus arteriosus did not completely close after birth?
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT...
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT What would be the effect on the sequences of the mRNA & tRNA & the final protein’s sequence? mRNA: transcribe mRNA using the following from the DNA string: T=A, A=U, G & C pair tRNA: transcribe tRNA using the following from the mRNA string: A & U pair, G & C pair Protein: using the Condon chart and the mRNA strand. What I do...
You have isolated a nonsense suppressor that maps to a the tRNA-leu gene. If the suppressor...
You have isolated a nonsense suppressor that maps to a the tRNA-leu gene. If the suppressor has a single point mutation in it, and it suppresses the 5’ UAG stop codon then, (a) what is the sequence of the anticodon in the mutated tRNA-leu gene and what was the original sequence before mutation? Show your work (codon-anticodon base pairing for example). (b) Would this suppressor also suppress termination of the UAA stop codon? Explain.
A. Which type of mutation do you feel would be most likely to be influenced by...
A. Which type of mutation do you feel would be most likely to be influenced by natural selection, those that result in changes of the third codon position, or those that result in changes of the first codon position? Explain your reasoning. B. In many animals inbreeding among close relatives reduces the ability of their offspring to survive. Explain why this occurs.
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT