Question

Short Essay Question EXPLAIN the R- gene responsive response in plants against pathogens; include a short...

Short Essay Question

EXPLAIN the R- gene responsive response in plants against pathogens; include a short discussion of the 2 defense responses

Homework Answers

Answer #1

R genes or the resistance genes in the plants mediate resistance to particular virus, bacteria, fungus or other pathogens. The R genes act by producing the proteins that bind directly to the pathogen or by recognizing the alteration of host proteins by the effector. About 100 to 600 R gene homologs are present in the plant immune systems, and the each individual homologue provides resistance to particular virus, bacteria, fungus, or other pathogens. These genes function to stop the spread of growth of the infection further.

For example, the R genes in tomato, i.e. Cf-9 and Cf-4 provide resistance against the fungus mold “Cladosporium fulvum.” The N gene coding for TIR-NB-LPR protein provides resistance to tobamovirus infection in Nicotiana glutinosa.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Short Essay Question: explain the concept of Double Fertilization (Plants)
Short Essay Question: explain the concept of Double Fertilization (Plants)
Short Essay. Please answer in essay form (at least 3 paragraphs per question) any 1 of...
Short Essay. Please answer in essay form (at least 3 paragraphs per question) any 1 of the 2 questions listed below. Choose one (1) of the following questions. Which of the three IPE approaches, Realism/Mercantilism (R/M), Classical-Liberalism (C-L), or Marxism/Structuralism (M/S), best accounts for the influence of fossil fuels (oil, coal, gas) in the IPE in the 21st century? Explain. - Or - Sustainable development is seen by some as a hopeful solution to many global issues. • What is...
Please read the following instructions. (1) Write a short essay on Ian Maitland’s article to explain...
Please read the following instructions. (1) Write a short essay on Ian Maitland’s article to explain the following: (i) the argument that market wages in international sweatshops are too low (or “unconscionable”); (ii) Ian Maitland’s counter-argument that rejects (i). (2) Explain the supporting reasons/evidence that Maitland uses and Use your judgement to decide what to include in your essay. 220 words max
Essay question 1-2 paragraphs each please: Use the idea of external costs to explain why some...
Essay question 1-2 paragraphs each please: Use the idea of external costs to explain why some cities have laws against late-night rock concerts.
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).
1. An antigen is A. a molecule that can elicit an immune response. B. a nucleic...
1. An antigen is A. a molecule that can elicit an immune response. B. a nucleic acid only. C. a protein or nucleic acid. D. a protective protein that the immune system produces. 2. The human leukocyte antigen genes are on the A. short arm of chromosome 6. B. long arm of chromosome 18. C. short arm of chromosome 2. D. long arm of chromosome 6. 3. Identifying combinations of _____ alleles is useful in tissue typing, establishing identity, and...
Please explain this answer in 1-2 paragraphs and include physics concepts. QUESTION: An electrical circuit has...
Please explain this answer in 1-2 paragraphs and include physics concepts. QUESTION: An electrical circuit has three devices each plugged into a standard household powerpoint. Device A has a resistance of 1.0 kΩ (kiloohm), device B has a resistance of 3.0 kΩ and device C has a resistance of 6.0 kΩ. If all three devices are turned on for 15 minutes, what will the total energy consumption of the three devices? ANSWER: Household Powerpoint Device A – 1.0 kiloohm (kΩ)...
Cell Biology Short Answer Question (250-300 words): Cystic Fibrosis Transmembrane conductance Regulator (CFTR) is an ABC...
Cell Biology Short Answer Question (250-300 words): Cystic Fibrosis Transmembrane conductance Regulator (CFTR) is an ABC transporter that allows passage of chloride ions across the plasma membranes of epithelial cells. Mutations in the gene for CSTR cause a decrease in fluid and salt secretion by CFTR and result in cystic fibrosis. In 70% cases of the disease, the mutation is a deletion of a Phe residue at position 508. The mutant protein folds incorrectly, which interferes with its insertion in...
Question 12 Section B: Essay and short answer questions / Business Cycles Strides for Strides manufactures...
Question 12 Section B: Essay and short answer questions / Business Cycles Strides for Strides manufactures and sells athletic wear to retail stores, who then stock the goods and sell them to customers. Its range of products includes warm-up tracksuits, body suits and running shoes and spikes. The business process followed by Strides for Strides in supplying retail stores is as follows: ·         The retail store will send an order to Strides for Strides, where it will be received by the...
Please answer this question in short essay form (2-4 paragraphs) Considering that cultures as complicated and...
Please answer this question in short essay form (2-4 paragraphs) Considering that cultures as complicated and socially constructed through the communicative interaction of organizational members. Briefly describe how the organizational concepts of complicated, emergent, unitary, and ambiguous apply to the sample auto-ethnography. Sample Auto-ethnography: Required Reading Auto-ethnography of College X Joe Student Organizational Culture and Diversity 223-58000 “The organization’s culture has both a direct and an indirect impact on the allocation of power among diverse groups. The values and ideologies...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT