Question

one strand of a DNA molecules has the sequence of 5' ATGCAGA 3' the complementary strand...

one strand of a DNA molecules has the sequence of 5' ATGCAGA 3'
the complementary strand would have the sequence
is 3'TACGTCT5' ????
Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3'...
5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3' ends)? b) underline the pyrimidines in the given sequence c) what other components are also part of a DNA double strand molecules but are NOT indicated in this strand?
A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
if one strand of a DNA molecule has the sequence of bases 5'ATTGCA3', mRNA which transcribes...
if one strand of a DNA molecule has the sequence of bases 5'ATTGCA3', mRNA which transcribes from this strand would have the sequence * a..5'..UAACGU..3'. b..3'..TAACGT..5'. c..5..'TAACGT..3'. d..5'..AUUGCA..3'. how the ans. is D? i thought it is A
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
If one strand of DNA has a sequence of ATGCTGCGGGCT. What is the sequence of the...
If one strand of DNA has a sequence of ATGCTGCGGGCT. What is the sequence of the other strand.
Suppose there is a strand of DNA that has the following sequence on one strand: ATTCAGGC....
Suppose there is a strand of DNA that has the following sequence on one strand: ATTCAGGC. What is the sequence of bases on the matching strand?
how many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CCACTAT-3'
how many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CCACTAT-3'
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-GGAAGAC-3'
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-GGAAGAC-3'
Below is a single strand of a DNA duplex, listed 5’ to 3’. 5’-GGGGGATGTCGACTTGATCTGATATCGGGGGTGTGATATCTGCAAAGATCTGCTATTTT-3’ Under this...
Below is a single strand of a DNA duplex, listed 5’ to 3’. 5’-GGGGGATGTCGACTTGATCTGATATCGGGGGTGTGATATCTGCAAAGATCTGCTATTTT-3’ Under this single strand, write the primary sequence of the complementary strand (3’ to 5’) and show any resulting DNA fragments (including any overhanging bases) that from digestion of the above duplex with Bglll.
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT