Question

Cellular Dysfunction -Decreased pH in cytosol below the normal range -Decreased pH in mitochondria below the...

Cellular Dysfunction

-Decreased pH in cytosol below the normal range

-Decreased pH in mitochondria below the normal range

-Increase in Hydrolysis

-Inherited Autosomal Recessive Mutation of hydrolytic enzymes

-Increased activity of mitogen-activated protein kinase(s)

-Poor Ion transport

1. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the items listed in your challenge. This means explaining how all aspects of the cell (inside and outside) may be impacted by these problems. The chain reaction of the system inside the cell.

a. Make sure to fully explain all of the items listed in the cellular dysfunction as well as all other related items in the system of a cell.

2. Identify and explain any causes that you believe may be associated with these cellular problems in one cell.

3. Explain how your team plans to fix the one cell with these problems using cell biology and bioscience applications, such as Gene Therapy, etc.

Homework Answers

Answer #1

All these cellular dysfunctions causes a disease called lysosomal storage disease.

The subcellular organelle lysosomes are responsible for the physiologic turnover of cell constituents.

Lysosomes are subcellular organelles responsible for the physiologic turnover of cell constituents. They contain catabolic enzymes, which require a low pH environment in order to function optimally. Lysosomal storage disease belongs to heterogenous group of dozens of rare autosomal storage disorders characterized by the accumulation of undigested or partially digested macromolecules. This causes cellular dyfunction and clinical abnormalities.

Enzyme replacement therapy is the potential therapy which now these days is using for the treatment of lysosomal storage disorders.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
The given situation is in regards to a single cell with cellular dysfunction and it's showing...
The given situation is in regards to a single cell with cellular dysfunction and it's showing these symptoms: Decreased pH in cytosol below the normal range 2. Decreased pH in mitochondria below the normal range 3. Increase in ATP 4. Increase in Hydrolysis 5. Decreasing levels of Glycogen and Triglycerides 6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue) - Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA - Mutated...
READ THE CASE STUDY AND ANSWER THE FOLLOWING QUESTIONS 2nd CASE: An Unexplained Death A 65-year-old...
READ THE CASE STUDY AND ANSWER THE FOLLOWING QUESTIONS 2nd CASE: An Unexplained Death A 65-year-old man of Scandinavian descent was rushed to the Emergency Room of your local hospital after a family member discovered him unconscious in his home. The woman who dialed “911” told the dispatcher that the man, her brother, was the local librarian of the past 10 years and had no spouse or children. She reported that they had spoken the day before, and he had...
Please read the article and answear about questions. Determining the Value of the Business After you...
Please read the article and answear about questions. Determining the Value of the Business After you have completed a thorough and exacting investigation, you need to analyze all the infor- mation you have gathered. This is the time to consult with your business, financial, and legal advis- ers to arrive at an estimate of the value of the business. Outside advisers are impartial and are more likely to see the bad things about the business than are you. You should...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT