Question

The human genome has a GAPDH gene, and the mouse genome also has a GAPDH gene....

The human genome has a GAPDH gene, and the mouse genome also has a GAPDH gene. The human GAPDH gene and the mouse GAPDH gene are over 90% identical in DNA sequence. What terms are appropriate for the relationship between the human and the mouse GAPDH genes? (select all that apply)

a.

paralogous

b.heterozygous

c.orthologous

d.homologous
Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Answer: Choice C

Reason: Among the different modes of gene descent and speciation, the emergence of orthologous and paralogous genes remains one of the most important observation. Paralogous genes arise due to different in copy number or by simple gene duplication in different species. Orthologous genes are genetic sequences highly similar in different species which arise due to descent of the different species with evolution. Thus, the presence of slightly different sequence for GAPDH in human and mouse corresponds to orthologous genes.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
5. A gene in the nuclear genome of an organism appears to be an ortholog of...
5. A gene in the nuclear genome of an organism appears to be an ortholog of a gene in the mitochondrial genome of another species. A friend argues that this is evidence against the endosymbiotic theory. Is this a valid argument? No, because during evolution of different taxa, transfer of genes between the nuclear and mitochondrial genomes is common, and different species have undergone transfer of different genes. No, because there is no way mitochondrial genes could end up in...
The Human Genome Project (HGP) is an international scientific research project with the goal of determining...
The Human Genome Project (HGP) is an international scientific research project with the goal of determining the sequence of nucleotide base pairs which make up human DNA, and of identifying and mapping all of the genes of the human genome from both a physical and a functional standpoint. Some people advocate the use of this knowledge to ultimately develop gene therapy. The goal of gene therapy would be to find alleles that are “faulty” and to correct them with normal...
How is the mouse Sey gene able to rescue the function (and vision) of a fly...
How is the mouse Sey gene able to rescue the function (and vision) of a fly with a deleted ey gene when only 29% of the amino acids between the mouse Sey and the fly ey gene are identical? What is the difference between a mutation and a polymorphism? Humans and chimpanzees have almost identical genes, but there is evidence that ________ occurred millions of years ago. How many occurrences of ________ have led to the differences between the two...
What are some effects of gene therapy? Select all that apply. 1. Cut faulty DNA out...
What are some effects of gene therapy? Select all that apply. 1. Cut faulty DNA out of cells 2. Insert “healthy” genes into cells 3. Silence genes that cause diseases 4. Make possible the transmission of healthy genes to offspring 5. Introduce DNA from a different species into human cells 6. Potentially enhance performance or appearance
5- The human genome consists of: 45 individual chromosomes 46 chromosomes (23 pairs) 42 chromosomes (22...
5- The human genome consists of: 45 individual chromosomes 46 chromosomes (23 pairs) 42 chromosomes (22 pairs) 23 individual chromosomes 6- A specific sequence of DNA that codes for a particular protein. chromosome genome gene chromatid 7- In the cell cycle, M phase is NOT considered a part of interphase. True False 8- At the end of ______________ each cell is genetically identical to the parental cell. At the end of ______________ each cell received ½ the genome of the...
A Scientist has discovered a human gene from cancer cells. The nucleotide sequence of the template...
A Scientist has discovered a human gene from cancer cells. The nucleotide sequence of the template strand of the gene was determined as written below: 3'GACACGTACGAGCCTGGACACCTTAAGAGCGGGCTCGGAACACTGGCCCCGATTGACAC 5' Write down the nucleotide sequence of the DNA fragments produced after EcoRl digestion of this gene. Please explain
Question Use the UCSC genome browser to find out how many exons are in the human...
Question Use the UCSC genome browser to find out how many exons are in the human gene MESP1 ? Answer 2 Which of the following is complementary strand of DNA to the following sequence. 5?ACTCGGTAA 3? Answer 3?TGAGCCATT 5? I know the answers. What I am asking is how can you tell me in detail how to solve it please its for bioinformatics.
1). What were the justifications given for funding the Human Genome Project? A). Scientific discoveries B)....
1). What were the justifications given for funding the Human Genome Project? A). Scientific discoveries B). Facilitate technological advances C). Understanding and treating human diseases D). Economic impact E). All of the above. 2). What are some of the concerns with using transcriptional Fusion reporter gene constructs to following the expression of the gene of Interest? A ). The reporter gene fused to the gene of Interest may interfere with the proper folding and function of protein product of the...
A 3000 bp region of the human genome encodes two genes. One of the genes encodes...
A 3000 bp region of the human genome encodes two genes. One of the genes encodes a protein of 700 amino acids and the other gene encodes a protein of 310 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences. How is this possible? That's all the information given. How are there no overlaps? Thats what I don't understand, I know there are 2100 base pairs and and 900 base pairs,...
You are studying a mouse gene named MtoA. You know that the protein product of this...
You are studying a mouse gene named MtoA. You know that the protein product of this gene localizes to mitochondria in mice. Your goal is that you want to know whether mouse MtoA protein is capable of localizing to mitochondria if produced in yeast cells. You decide to clone a gene into a translational fusion vector that will add jellyfish DNA sequence encoding the GFP proteins (238 amino acids) in place of the normal stop codon. Unfortunately, you can't find...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT