Question

What determines whether a gene is transcribed or not ?

What determines whether a gene is transcribed or not ?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

This depends on the other proteins that are present in the cell. These proteins are collectively known as "transcription factors".

Every gene consists of a protein coding sequence which begins with a start codon and ends with a stop codon. Apart from this, a gene must have regulatory sequences associated with it. The regulatory sequences act as binding sites for RNA polymerase and its accessory molecules. The regulatory sequences with their bound proteins dictate the activity state of the gene. The regulatory sequences contain the promoter region together with enhancer elements.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A mutation in a gene in E. coli causes the gene to be transcribed at a...
A mutation in a gene in E. coli causes the gene to be transcribed at a greatly diminished level. What is the most likely reason that this happened?
Explain whether the lac operon would be transcribed in a mutant that is completely missing the...
Explain whether the lac operon would be transcribed in a mutant that is completely missing the EIIA^GLC gene. Include your reasoning.
In squash, the fruit can be white, green, or yellow. One gene determines whether the fruit...
In squash, the fruit can be white, green, or yellow. One gene determines whether the fruit will be white or colored, while another gene determines whether a colored fruit will be yellow or green. Recall that yellow (Y) is dominant over green (y), and white (W) is dominant over color (w). If a squash has yellow fruit, could it have had a white parent? Could it have had a green parent? Start by writing the possible genotypes for a squash...
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a)...
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a) Find the protein-coding sequence and provide the amino acid sequence of the encoded protein (b) Which amino acid is at the C-terminus of this peptide?
How does gene organization in prokaryotes and eukaryotes affect (influences, dictates, determines) gene expression?
How does gene organization in prokaryotes and eukaryotes affect (influences, dictates, determines) gene expression?
The template strand of a transcribed gene is preferentially repaired because: a. it allows DNA replication...
The template strand of a transcribed gene is preferentially repaired because: a. it allows DNA replication folks move faster. b.the altered secondary structure of the RNA it produces is likely to be recognized by repair enzymes. c.it contains specific sequences for binding repair enzymes. d.damage on the nontemplate strand is less likely to result in mutation.
During transcription, the sequence of nucleotides in a gene in the DNA determines the sequence of...
During transcription, the sequence of nucleotides in a gene in the DNA determines the sequence of ________ in mRNA. Proteins are polymers of 20 different types of amino acids. During translation, the sequence of nucleotides in mRNA determines the sequence of _________ in the protein.
What is a gene knockout (KO)? Indicate whether the gene expression is regulated at transcriptional and/or...
What is a gene knockout (KO)? Indicate whether the gene expression is regulated at transcriptional and/or translational level. Briefly explain your answer.
What determines whether an individual is a net borrower or a net lender?
What determines whether an individual is a net borrower or a net lender?
Here’s an uncompleted table of a segment of the transcribed region of a gene in a...
Here’s an uncompleted table of a segment of the transcribed region of a gene in a prokaryote. Fill in the empty slots of this table with the appropriate nucleotide/amino acid based on the information you have here. (This requires that you use your awesome knowledge from previous weeks in this unit as well, but you can do it! I know this is challenging, but it’s not impossible. You have enough information here to crack this thing wide open.) DNA double...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT