Question

1. The strand that has stopped following the splitting of the original strands is called the...

1. The strand that has stopped following the splitting of the original strands is called the ____________ strand.

2. The strand moving away from the splitting of the original strands is called the _______________ strand.

3. The strand from #1 is done in fragments. These are called __________.  

4. How are these fragments connected together?

Homework Answers

Answer #1

Answer-

1-lagging strand - it runs in opposite direction from parent strand in 5' to 3' direction and is discontinuoulsy synthesised .

2- leading strand - it runs in the same direction as parent strand in 3' to 5' direction and is continuously replicated.

3- okazaki fragments - the discontinous synthesis of dna strands forms dna fragments called okazaki fragments

4-DNA ligase - enzyme which joins together okazaki fragments.

if thIs helps please give it a positive rating thank you!

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
QUESTION 1 * Compared to the leading strand, the lagging strand requires ________ primers.?? A. more...
QUESTION 1 * Compared to the leading strand, the lagging strand requires ________ primers.?? A. more B. the same number of C. less QUESTION 2 * Which enzyme synthesizes the majority of the DNA polymer for both the leading and lagging strands??? A. DNA polymerase I B. primase C. DNA polymerase III D. helicase QUESTION 3 * For each origin of replication, how many DNA polymerase III enzymes are needed??? A. 1 B. 8 C. 4 D. 2 QUESTION 4...
If there are two fragments of RNA say strand 1 and strand 2 to be "stitched"...
If there are two fragments of RNA say strand 1 and strand 2 to be "stitched" together (both sequence 1 and 2 going in 5' to 3' direction), for example, strand 1 is 5' AAUGACCAC 3' and strand 2 is 5' AAGCUCGCGGCCGUACAUCUU 3', would the stitching be done as strand 1+strand 2 - 5' AAUGACCACAAGCUCGCGGCCGUACAUCUU 3' or strand 2+strand 1? - 5' AAGCUCGCGGCCGUACAUCUUAAUGACCAC 3' I understand RNA is always made in 5' to 3' direction but both seem to be...
A 100 base pair double strand is 20% A 1. How many bases ( in number)...
A 100 base pair double strand is 20% A 1. How many bases ( in number) are T? 2. What percentage of bases are C? 3. How many hydrogen bonds hold the strands together?
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
1. What determines the sequence of nucleotides on the newly synthesized strands during DNA replication? a....
1. What determines the sequence of nucleotides on the newly synthesized strands during DNA replication? a. the nucleotide sequence of the template strand b. the way that the parental DNA strands are untangled by topoisomerase. c. the genetic code, as specified by the RNA reading frame d. the nucleotide sequence of the coding strand 2. A difference between meiosis and mitosis is that_________. a. DNA replication occurs twice in meiosis but only once in mitosis b. sister chromosomes are always...
12. You have a short piece of DNA. One strand has the following sequence: 5’ AGCTACTCCTAA...
12. You have a short piece of DNA. One strand has the following sequence: 5’ AGCTACTCCTAA 3’. a. Please write down sequence of the other strand, starting with the 5’ end. (0.2 pt) b. If these two strand wind together as a B form DNA, how long do you expect this DNA to be? (0.2 pt) c. How many hydrogen bonds are there to stabilize the structure of this DNA? (0.2 pt) d. Besides hydrogen bonds, what other forces stabilize...
Are the following correct? 1. Predict the splitting patern you would observe for the proton at...
Are the following correct? 1. Predict the splitting patern you would observe for the proton at C1 of 2,3-dimethyl-2-phenylbutane --> First off, which one is the C1 carbon? I am assuming it is the carbon attached to the benezine ring - Hence making the answer a singlet? 2. Which of the following m/z values corresponds to the molecular ion for the following compound --> C6H14O (2-hexanol)? C=12x6=72, O=16 and H=1x14=14. Combined I'm getting 102. However, in mass spec. the molecular...
Answer the following about NMR analysis of ACETONE: 1. number of signals 2. integration 3. splitting
Answer the following about NMR analysis of ACETONE: 1. number of signals 2. integration 3. splitting
Molecular Biology and Biochemistry A DNA strand which is used as the template for transcription is...
Molecular Biology and Biochemistry A DNA strand which is used as the template for transcription is known as the ________. leading strand sense strand antisense strand lagging strand coding strand Sickle cell disease results from a point mutation of the __________. α-globin of hydrophilic amino acid for a hydrophobic amino acid β-globin of histidine for glycine β-globin of valine for glutamate γ-globin of proline for tyrosine γ-globin of glutamate for guanine Which of the following molecules has RNA-dependent DNA polymerase...
Question 7 Use the illustration below to answer the next 5 questions.   A plasmid called pKSU1 is...
Question 7 Use the illustration below to answer the next 5 questions.   A plasmid called pKSU1 is shown on the left.  A piece of genomic DNA isolated from another organism is on the right.  The cut sites for three restriction enzymes are shown (SelI, HerII, HimIII) for both. Your goal is to insert the gene of interest from the genomic DNA into pKSU1. Which restriction enzyme(s) would you digest the genomic DNA with to obtain a smaller fragment that contains the gene of...