Question

A Scientist has discovered a human gene from cancer cells. The nucleotide sequence of the template...

A Scientist has discovered a human gene from cancer cells. The nucleotide sequence of the template strand of the gene was determined as written below: 3'GACACGTACGAGCCTGGACACCTTAAGAGCGGGCTCGGAACACTGGCCCCGATTGACAC 5' Write down the nucleotide sequence of the DNA fragments produced after EcoRl digestion of this gene. Please explain

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

the recognition sequence of Ecori is 5'G|AATTC'3

3'CTTAA|G'5

This "|" symbol signifies the site where the enzyme cuts the DNA strand.

The enzyme's recognition sequence is pallindromic as shown above and produces sticky ends after the digestion

3' GACACGTACGAGCCTGGACACCTTAA|GAGCGGGCTCGGAACACTGGCCCCGATTGACAC'5

5' CTGTGCATGCTCGGACCTGTGG|AATTCTCGCCCGAGCCTTGTGACCGGGGCTAACTGTG '3

AFTER ECORI DIGESTION

3' GACACGTACGAGCCTGGACACCTTAA '5 3' GAGCGGGCTCGGAACACTGGCCCCGATTGACAC'5

5' CTGTGCATGCTCGGACCTGTGG'3 5' AATTCTCGCCCGAGCCTTGTGACCGGGGCTAACTGTG '3

Two fragments will be generated

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A student is tasked with cloning a specific gene-coding sequence from a human cancer cell in...
A student is tasked with cloning a specific gene-coding sequence from a human cancer cell in order to produce the corresponding protein in bacteria at a concentration sufficient to conduct in vitro biochemical studies. A) The student decides to use primers specific to the 5’ and 3’ ends of the human gene based on a genomic DNA sequence he found in the human genome database. After using a genomic library for PCR amplification, plasmid cloning, and bacterial transformation, the student...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
As part of a cancer research project, you have discovered a gene that is mutated in...
As part of a cancer research project, you have discovered a gene that is mutated in many metastatic tumors. After determining the DNA sequence of this gene, you compare the sequence with those of other genes in the human genome sequence database. Your gene appears to code for an amino acid sequence that resembles sequences found in some serine proteases. Conjecture how your new gene might contribute to the development of highly invasive cancers.
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
The cytosine nucleotide base of the dCpG dinucleotide DNA sequence in the human tumor suppressor gene,...
The cytosine nucleotide base of the dCpG dinucleotide DNA sequence in the human tumor suppressor gene, TP53, has been changed to dTpG by a mutation. Which of the following type of mutations is referred to this base change? (d=deoxy;p=phosphodiester bond; C=cytosine; G=Guanine;T=Thymine) Tranversion Deletion Transition
1)This stretch of DNA includes the beginning of the protein-coding region of a gene. The lower...
1)This stretch of DNA includes the beginning of the protein-coding region of a gene. The lower strand is the template strand. 5’...T A A T G A G T G T T G T T A G T ...3’ .    3’...A T T A C T C A C A A C A A T C A ...5’ ← template strand What is the corresponding mRNA that would be created from this portion of the gene? 2) This stretch of...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes the 3' untranslated sequence and the first part of the translated sequence. The promoter for this gene is TATAT. Transcription begins with the third base after the promoter. For each answer portion, in your response, write each one starting on a new line and please write A, B, C, etc. as you go. A)   Transcribe and B). translate this sequence into its final peptide...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).
3'- CCA TGT CCG GAA GTG AAT- 5' Using the same template DNA strand provided in...
3'- CCA TGT CCG GAA GTG AAT- 5' Using the same template DNA strand provided in question #1, transcribe and translate the DNA strand after the following mutations have occurred. You only need to provide the new amino acid sequence of the protein encoded after these mutations have occurred: a. A "C" to "T" base substitution at nucleotide position #8. b. A "T" to "C" base substitution at nucleotide position #6. c. Which one of these is more likely to...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT