Question

What amino acid substitutions would you make in histones to increase their binding to DNA? Briefly...

What amino acid substitutions would you make in histones to increase their binding to DNA? Briefly explain.

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

If negatively charged amino acids like aspartic acid or glutamate are substituted with the positively charged amino acid like lysine and arginine it will increase the binding of histone with DNA.

Reason- DNA is negatively charge and if negatively charged amino acid would be present they will repel the negatively charge DNA and will prevent the binding of histone to DNA. If positively charged amino acids are present they will attract negatively charged DNA and will strengthen the bonding.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Histones are an essential class of proteins for packaging DNA into chromosomes. Would you expect there...
Histones are an essential class of proteins for packaging DNA into chromosomes. Would you expect there to be more histones (proteins, not histone genes) per kilobase of DNA in euchromatin or in heterochromatin of a living cell? Why?
A.Human Hemoglobin does not bind Bicarbonate. Twelve amino acid substitutions had to be made in human...
A.Human Hemoglobin does not bind Bicarbonate. Twelve amino acid substitutions had to be made in human hemoglobin in order to force human hemoglobin to bind bicarbonate at the a1-B1 subunit interface. Yet, only three amino acids interact with the bicarbonate ion. Wht might be the role of the other 9 ammino acids in facilitating binding? B. The plausible bicarbonate binding site is at the interface between the crocodile hemoglobin a1-B1 subunit, where the two subunits slide with respect to each...
If you know the amino acid sequence in a cell,how do you determine the DNA ?...
If you know the amino acid sequence in a cell,how do you determine the DNA ? Please Explain
Guest and Yanofsky observed the following amino acid substitutions at one particular site, originally gly, on...
Guest and Yanofsky observed the following amino acid substitutions at one particular site, originally gly, on protein A of E. coli tryptophan synthetase: from gly to cys, from gly to asp and from asp to ala. A. Using a codon chart, what codons would fit this set of events if each of these mutations arose by a single base pair change? Indicate your answer for each amino acid change. B. Which of these mutations are transitions and which are transversions?...
The mRNA codon GCC specfies the amino acid alanine. Indentify what amino acids would apear in...
The mRNA codon GCC specfies the amino acid alanine. Indentify what amino acids would apear in a protein if each of the bases were replaced in a succession by another base? Ala, Ile, Leu. Val, Gly, Met, Pro, Phe, Trp, Asn, Glu, Arg, His, Lys, Thr Predict which of the following substitutions would be harmful to the protein in question?
Explain in details what histones are, how they interact with each other and with DNA, and...
Explain in details what histones are, how they interact with each other and with DNA, and how they contribute to the compaction of DNA and gene regulation.
What is the correct amino acid sequence for the following DNA nucleotide sequence: GTAACAGAAGTACTTCCAGTACTA
What is the correct amino acid sequence for the following DNA nucleotide sequence: GTAACAGAAGTACTTCCAGTACTA
Explain why is it impossible to take the amino acid sequence and determine the exact DNA...
Explain why is it impossible to take the amino acid sequence and determine the exact DNA code? (Detailed)
A DNA-binding protein is needed to be expressed and purified for structural studies. It has the...
A DNA-binding protein is needed to be expressed and purified for structural studies. It has the following properties: (a) It is a human protein; (b) The overall molecular mass is about 150 kDa; (c) It contains rare codons; (d) It has multiple charged and hydrophobic amino acid residues; (e) Its pI is 5.4; (f) It is sensitive to proteolytic degradation. Starting from the design for protein expression using an appropriate expression system, briefly describe how you would proceed logically to...
6. Which of the following can be manipulated to promote amino acid production in microbes? A....
6. Which of the following can be manipulated to promote amino acid production in microbes? A. Alteration of promotor to increase binding of the repressor. B. Decrease in cell membrane permeability to prevent release of the amino acid. C. Alteration of enzymes in pathways such as the TCA cycle to halt the pathway and “push” the intermediate towards the production of the amino acid. D. A and C. 8. Which of the following is true about Polymerase Chain Reaction (PCR)?...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT