Question

5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3'...

5'- CCTTAAGGCTAATAGCAGGT-3'

a) What is the sequence of the complementary DNA strand (indicate 5' and 3' ends)?

b) underline the pyrimidines in the given sequence

c) what other components are also part of a DNA double strand molecules but are NOT indicated in this strand?

Homework Answers

Answer #1

Ans

a) A double strand DNA is made up of two strands that have complimentary base pairing . So the sequence of the other strand will be :

3' - GGAATTCCGATTATCGTCCA - 5'

b) The pyrimidines present in DNA are thymine and cytosine .

These are underlined in the DNA strand as :

5' - CCTTAAGGCTAATAGCAGGT - 3'

c) DNA double strand has sugar , phosphate and nitrogenous base as the main components.

Here nitrogenous bases ( purines and pyrimidines) are shown , as well as the 5' and 3' ends of sugar are shown. The only component which is not indicated in this strand is the phosphate group.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
one strand of a DNA molecules has the sequence of 5' ATGCAGA 3' the complementary strand...
one strand of a DNA molecules has the sequence of 5' ATGCAGA 3' the complementary strand would have the sequence is 3'TACGTCT5' ????
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
DNA sequence. 5’-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT-3’ “Transcribe” and form an RNA transcript based on the DNA sequence. Illustrate the...
DNA sequence. 5’-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT-3’ “Transcribe” and form an RNA transcript based on the DNA sequence. Illustrate the amino acid sequence of the resulting polypeptide using the genetic code. *Please follow proper directionality of both the RNA strand and the polypeptide. Indicate clearly and label correctly the ends of the molecules mentioned. What is/are the characteristic feature/s of the resulting polypeptide based on the viral DNA sequence given?
A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
The following is the sequence of bases in the sense strand of a DNA segment and...
The following is the sequence of bases in the sense strand of a DNA segment and contains the beginning of a gene. DNA 3? A T A T T A C C A G G C A T G G A C C C C C G G G 5? Based on this sequence, write the sequence of the anti-sense DNA strand and the mRNA. Label the 5? and 3? ends in your predicted sequences. The start codon in this...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
how many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CCACTAT-3'
how many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CCACTAT-3'
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-GGAAGAC-3'
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-GGAAGAC-3'
Below is a single strand of a DNA duplex, listed 5’ to 3’. 5’-GGGGGATGTCGACTTGATCTGATATCGGGGGTGTGATATCTGCAAAGATCTGCTATTTT-3’ Under this...
Below is a single strand of a DNA duplex, listed 5’ to 3’. 5’-GGGGGATGTCGACTTGATCTGATATCGGGGGTGTGATATCTGCAAAGATCTGCTATTTT-3’ Under this single strand, write the primary sequence of the complementary strand (3’ to 5’) and show any resulting DNA fragments (including any overhanging bases) that from digestion of the above duplex with Bglll.
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT