Question

If one end of a simple transposable element contained the following sequence: 5'-CATCGGAAT-3' 3'-GTAGCCTTA-5' what would...

If one end of a simple transposable element contained the following sequence:

5'-CATCGGAAT-3'

3'-GTAGCCTTA-5'

what would be the sequence of the other end

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1


Simple transposable element is enclosed by short regions of inverted repeat sequences at both the terminal ends (labelled by red in the image). These inverted repeats are palindromic (mirror images) wherein base sequence of the second half in the DNA strand represents the mirror image of the base sequence of the first half i.e. the sequence of DNA reads the same on the two strands when orientation of reading is kept same (encircled by green in the image).

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
5' AGTTGTATAGAAAACTGCGAA 3' What DNA sequence (give as 5' to 3') would be formed by replicating...
5' AGTTGTATAGAAAACTGCGAA 3' What DNA sequence (give as 5' to 3') would be formed by replicating the sequence shown above? What RNA sequence (give as 5' to 3') would be formed by transcribing the sequence formed in part 1? What protein sequence (give as N to C terminus) would be formed by translating the sequence formed in part 2?
How many 5-element DNA sequences a) end with A? b) start with T and end with...
How many 5-element DNA sequences a) end with A? b) start with T and end with G? c) contain only A and T? d) do not contain C? Hint: Recall that a DNA sequence is a sequence of letters, each of which is one of A, C, G, or T. Thus by the product rule there are 4^5 = 1024 DNA sequences of length five if we impose no restrictions. discrete strctures
How many 5-element DNA sequences a) end with A? b) start with T and end with...
How many 5-element DNA sequences a) end with A? b) start with T and end with G? c) contain only A and T? d) do not contain C? Hint: Recall that a DNA sequence is a sequence of letters, each of which is one of A, C, G, or T. Thus by the product rule there are 4^5 = 1024 DNA sequences of length five if we impose no restrictions. discrete math discrete structures
Which of the following would be the correct complimentary DNA sequence for the following: 5'-TATATGGCGATATAGGG-3' A)3'-ATATACCGCTATATCCC-5...
Which of the following would be the correct complimentary DNA sequence for the following: 5'-TATATGGCGATATAGGG-3' A)3'-ATATACCGCTATATCCC-5 B) 5'-ATATACCGCTATATCCC-3' C) 3'-AUAUACCGCUAUAUCCC-5
How do you seal sequence 2 (from 5 ' end) to the 3' end of the...
How do you seal sequence 2 (from 5 ' end) to the 3' end of the sequence 1 in vitro condition ?Design a splint oligomer and write the all-possiblecontent(s) needed for reaction to occur. Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3' Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'
One element of recombinant signal sequence includes: A less conserved spacer of either 12 or 23...
One element of recombinant signal sequence includes: A less conserved spacer of either 12 or 23 bp. A more conserved spacer of either 12 or 23 bp. An absolutely conserved spacer, 7 bp, consensus sequence 3’-CACAGTT-5’ A single conserved, 10 bp consensus sequence 5’-ACAAAAACCC-3’
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
2.If the following DNA sequence was the template for transcription, what RNA sequence would be synthesized?...
2.If the following DNA sequence was the template for transcription, what RNA sequence would be synthesized? 3' GTCCATCAT 5'
5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3'...
5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3' ends)? b) underline the pyrimidines in the given sequence c) what other components are also part of a DNA double strand molecules but are NOT indicated in this strand?
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT