Question

You are studying disease X, a genetic disorder that arises from a trinucleotide repeat expansion mutation which is a mutation where entire codons are multiplied during the replication process. The mutation is found in the CaM gene, that is a 450-base pair (bp) sequence. The trinucleotide repeat expansion results in the addition of 10 codons (30 bp) at nucleotide 150 (ie in the centre of the gene, away from the 5’ and 3’ end). The sequence of the normal gene is shown below.

ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTTGATAAAGATG GCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTGGGTCAGAACCCAACAGAAGC TGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGTAATGGCACCATTGACTTCCCCGAATTTTTG ACTATGATGGCTAGAAAAATGAAAGATACAGATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTG ACAAGGATGGCAATGGTTATATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACT AACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAA GAATTCGTACAGATGATGACTGCAAAATGA

a) Design primers for the amplification of this gene

b) Design a PCR-based method to detect this disorder in patients.

c) Describe or draw your expected results for an individual with the disease vs. a healthy individual control.

d) A sample collected from a patient with similar symptoms to those suffering from Disease X has been brought to the lab. You use your PCR based test and determine that the CaM gene is the same size as that of a healthy individual. You suspect that the arises from a point mutation (a single nucleotide change that results in a defect in the protein.) Describe a how you could confirm this hypothesis.

Answer 1

a) Primers for the amplification of the entire gene:

Forward primer: 5'-ATGGCTGATCAGCTGACCGAAG-3'

Reverse primer: 5'-TCATTTTGCAGTCATCATCTGTAC-3'

b) The primers must flank the region of difference between the WT and mutant.

Forward primer: 5'-CAACAGAAGCTGAATTGCAG-3'

Reverse primer: 5'-CAAAAATTCGGGGAAGTCAA-3'

c) Isolate genomic DNA from WT and mutant individuals. Perform PCR using the given primers. Run the PCR products on the gel.

WT product size = 80 bp

Mutant product size = 110 bp

d) See image

e) If the disease is not due to triplet repeat expansion, we have to sequence the entire gene for the presence of any other SNP.

Please rate the solution. Your efforts are highly appreciated. Thank you.