Question

Which mutation leads to cell death regardless of what nucleotide is altered in the DNA strand?

Which mutation leads to cell death regardless of what nucleotide is altered in the DNA strand?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

cells with base change mutations are more prone to get eliminated by apoptosis ( Programmed cell death). After a mutation occur it goes to immediate repair response where replication, cell division, transcription etc all processes get halted. Only after repair things get to normal or otherwise elimination of cell. In case of base mutation enzyme cannot recognise mutation and it remains in DNA. It lead to abnormalities in cell function which ultimately leads to cell death as soon as abnormalities recognised by apoptotic factors.

If it was helpful, give a thumps up

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
On occasion, DNA polymerase will incorporate a wrong nucleotide in the new DNA strand, resulting in...
On occasion, DNA polymerase will incorporate a wrong nucleotide in the new DNA strand, resulting in a mismatch pair. Which of the following is the more commonly produced mismatch? Group of answer choices AT GT GC CC When a new strand of DNA is being synthesized, Group of answer choices An ionic bond at the 3’ position of the existing strand and the 5’ position of the new nucleotide is generated A phosphodiester bond at the 3’ position of the...
During DNA replication, after adding each nucleotide to a new strand of DNA, DNA polymerase checks...
During DNA replication, after adding each nucleotide to a new strand of DNA, DNA polymerase checks that the nucleotide it just added is the correct one, i.e. that it is complementary to the opposite nucleotide on the template strand. This activity is called the ____________ activity of DNA polymerase. If this activity detects that a wrong nucleotide has been added, then the _____________ activity of DNA polymerase is activated, allowing the wrong nucleotide to be removed.
along one strand of a DNA double helix is the nucleotide sequence GGCATAGGT. what is the...
along one strand of a DNA double helix is the nucleotide sequence GGCATAGGT. what is the sequence for the mRNA strand
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
if there is a mutation that occurs on the seventh DNA codon on the template strand...that...
if there is a mutation that occurs on the seventh DNA codon on the template strand...that transforms a Guanine to an Adenine in the sequence. What would be the overall effect on the synthesis of the protein and why?
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will...
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will be amplified by PCR using short primers:      5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3'      Primers that could be used to amplify this entire DNA fragment are: A) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ B) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ C) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ D) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ E) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
What makes lagging strand DNA synthesis so much more of a challenge for the cell than...
What makes lagging strand DNA synthesis so much more of a challenge for the cell than leading strand DNA synthesis?
During DNA replication, DNA polymerase is only used to replicate the leading strand (Polymerase is not...
During DNA replication, DNA polymerase is only used to replicate the leading strand (Polymerase is not used on the lagging strand). True False The phrase "DNA replicating away from helicase" describes the lagging strand. True False The phosphate-sugar backbone connects nucleotides within a strand using ____ bonds between the phosphate of one nucleotide and carbon number ___ of the previous nucleotide. hydrogen..... 5' covalent..... 3' covalent..... 5' hydrogen..... 3' Which bonds are broken during DNA replication? hydrogen bonds phosphodiester bonds...
The template strand of a transcribed gene is preferentially repaired because: a. it allows DNA replication...
The template strand of a transcribed gene is preferentially repaired because: a. it allows DNA replication folks move faster. b.the altered secondary structure of the RNA it produces is likely to be recognized by repair enzymes. c.it contains specific sequences for binding repair enzymes. d.damage on the nontemplate strand is less likely to result in mutation.
Molecular Biology and Biochemistry A DNA strand which is used as the template for transcription is...
Molecular Biology and Biochemistry A DNA strand which is used as the template for transcription is known as the ________. leading strand sense strand antisense strand lagging strand coding strand Sickle cell disease results from a point mutation of the __________. α-globin of hydrophilic amino acid for a hydrophobic amino acid β-globin of histidine for glycine β-globin of valine for glutamate γ-globin of proline for tyrosine γ-globin of glutamate for guanine Which of the following molecules has RNA-dependent DNA polymerase...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT