Question

A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence

A certain DNA has the sequence: ACTGACTGT. The complementary mRNA strand will have the sequence
Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

The complementary mRNA strand will have the sequence: U G A C U G A C A

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
one strand of a DNA molecules has the sequence of 5' ATGCAGA 3' the complementary strand...
one strand of a DNA molecules has the sequence of 5' ATGCAGA 3' the complementary strand would have the sequence is 3'TACGTCT5' ????
5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3'...
5'- CCTTAAGGCTAATAGCAGGT-3' a) What is the sequence of the complementary DNA strand (indicate 5' and 3' ends)? b) underline the pyrimidines in the given sequence c) what other components are also part of a DNA double strand molecules but are NOT indicated in this strand?
if one strand of a DNA molecule has the sequence of bases 5'ATTGCA3', mRNA which transcribes...
if one strand of a DNA molecule has the sequence of bases 5'ATTGCA3', mRNA which transcribes from this strand would have the sequence * a..5'..UAACGU..3'. b..3'..TAACGT..5'. c..5..'TAACGT..3'. d..5'..AUUGCA..3'. how the ans. is D? i thought it is A
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
along one strand of a DNA double helix is the nucleotide sequence GGCATAGGT. what is the...
along one strand of a DNA double helix is the nucleotide sequence GGCATAGGT. what is the sequence for the mRNA strand
If one strand of DNA has a sequence of ATGCTGCGGGCT. What is the sequence of the...
If one strand of DNA has a sequence of ATGCTGCGGGCT. What is the sequence of the other strand.
What is the funcional of the enzyme DNA polymerase in replication? A) It reads the sequence...
What is the funcional of the enzyme DNA polymerase in replication? A) It reads the sequence of nucleotides on the parental strand of DNA and catalyzes the polymerization of a complementary daughter DNA strand. B) Its reads codond on a DNA molecule and catalyzes the polymerization of a complementary mRNA strand, C) It unwinds the double helix of DNA and separetes the two strand. D) It connects the short Okazaki fragments formed in the lagging strand. E) It carries the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT