Question

2.If the following DNA sequence was the template for transcription, what RNA sequence would be synthesized?...

2.If the following DNA sequence was the template for transcription, what RNA sequence would be synthesized?

3' GTCCATCAT 5'

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Transcription is the process of producing RNA from the DNA template. In RNA the complementary sequence are

A-U

T-A

G-C

C-G.

In RNA uracil is the complementary nucleotide of adenine instead of thymine.

So, when adenine is present in the DNA then Uracil will be added to the RNA.

when thymine is present in the DNA then adenine will be added to the RNA.

when guanine is present in the DNA then cytosine will be added to the RNA.

when cytosine is present in the DNA then guanine will be added to the RNA.

Therefore if the DNA strand is 3'--GTCCATCAT- 5'

then its complementary RNA will be 5'--CAGGUAGUA--3'

The direction of RNA synthesis is 5' to 3'direction

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
RNA polymerase is incubated with a DNA template, all the necessary transcription factors, and the substrates:...
RNA polymerase is incubated with a DNA template, all the necessary transcription factors, and the substrates: ATP, GTP, CTP, and UTP. Each ribonucleotide 5’-triphosphate substrate is labeled with 18O in the β-phosphate group and 13C in the ribose. What labeled RNA is produced? Group of answer choices: The newly synthesized RNA will have 13C-ribose at every nucleotide residue, but no 18O-atoms incorporated. The newly synthesized RNA will have an 18O-atom and a 13C-ribose at every nucleotide residue. The newly synthesized...
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA...
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA nucleotides. Many regulatory factors can help facilitate the transcription processes. One region that affects transcription is the terminator region, which is located on mRNA, downstream of the coding segment on DNA, in the 5' end of the gene on DNA, downstream of the coding segment on mRNA at the 5' end on DNA, within the coding region
RNA polymerase: A) moves along the template DNA strand (anti sense) in the direction opposite to...
RNA polymerase: A) moves along the template DNA strand (anti sense) in the direction opposite to the direction in which the RNA is being synthesized B) elongates RNA strands in 3-5 direction C) uses individual deoxyribonucleide 5'- triphosphate to synthesize RNA D) requires primer to initiate synthesis of RNA E) moves along the non template DNA strand (sense) in the directino opposite to the direction in which RNA is synthesized
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
1. To initiate transcription, RNA polymerase must recognize the ____ sequence on DNA. 2. Ribosomal 30S...
1. To initiate transcription, RNA polymerase must recognize the ____ sequence on DNA. 2. Ribosomal 30S subunit binds to mRNA by recognizing ______ sequence upstream of the start codon. (Full name for full credit) 3. A special initiator tRNA called ______ binds to the ______ site of the 70S ribosome for base pairing with the ATG start codon. 4. If RNA polymerase transcribes a long mRNA encoding more than one polypeptide, it is called a (an) _______ RNA. 5. Some...
Suppose the DNA template sequence 5'-GGC GAC CCC CAC-3’ was replicated by a DNA polymerase. Write...
Suppose the DNA template sequence 5'-GGC GAC CCC CAC-3’ was replicated by a DNA polymerase. Write the resulting replication product sequence (in proper 5’ -> 3’ orientation!). Also right the resulting replication product sequence if the DNA template sequence 5'-GAC GAA CAC CCC-3’ was transcribed by a RNA polymerase.
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
1. Which of the following is CORRECT concerning transcription of E. coli genes? A. Transcription termination...
1. Which of the following is CORRECT concerning transcription of E. coli genes? A. Transcription termination may involve rho factor B. Sigma factor is required for elongation of a RNA chain C. Melting or unwinding of a DNA template is achieved by a helicase D. Both DNA strands in a gene are transcribed from one promoter 2. Math the items: 1. mRNA, 2. rRNA, 3. tRNA, 4. exon, 5. intron A. Synthesized by RNA Polymerase lll in eukaryotes: B. Is...
Q1 : put the following of protein synthesis transcription steps in the correct order A- the...
Q1 : put the following of protein synthesis transcription steps in the correct order A- the RNA-pol stops transcribed when reaching a repetitive sequences of T nucleotides B- the 3"segments of the nascent RNA hybridizes with the DNA template , and its 5'end extends out the transcription C- after DNA transcription passes , the two DNA strands reform D- RNA-pol start move on the DNA template melting and unwinding the double helix F- the transcript RNA strand is released G-...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT