Question

2. Fill in the banks: In the structure of a gene, the information encoding_________ is located...

2. Fill in the banks: In the structure of a gene, the information encoding_________ is located furthest away from the promoter.

a.The 5' end of the protein

b. The N Terminus of the protein

c. the 3' end of the protein

d. the c terminus of the protein

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Option D-the c terminus of the protein

Translation is the process in which proteins are formed from m RNA.

Translation starts at the promotor in the 5' end of m RNA.The codons of the mRNA are  translated in 5′→3′ direction into amino acids.

*The N-terminus- the1st part of the protein that exits the ribosome during Translation.

*C-Terminus  - the end of an amino acid chain which is terminated by a free carboxyl group.

SO ,Option D-Correct.

Option A and C are wrong-5' and 3' end corresponds to m RNA,not proteins.

Option B-Wrong,Because N terminal is formed first and C terminus is formed last.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
part 8 Which statement is TRUE about genes? A. promoter marks the end of a gene...
part 8 Which statement is TRUE about genes? A. promoter marks the end of a gene B. genes are located on chromosomes C. genes can function as enzymes D. all parts of a gene is copied RNA One of the reasons why a cell would activate a gene only if its product is required, is; A. to prevent telomere shortening B. to minimize mutations C. for fast response D. to conserve energy Most point mutations that could cause genetic disorders...
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a)...
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a) Find the protein-coding sequence and provide the amino acid sequence of the encoded protein (b) Which amino acid is at the C-terminus of this peptide?
4. in transcription, the ______ is made first. In translation, the_______ is made first. (check the...
4. in transcription, the ______ is made first. In translation, the_______ is made first. (check the right ones for each box) a. C terminus of protein b. 3' end of protein c. 5' end of protein d. N terminus of protein
5. Both epigenetic and genetics can affect gene expression. Below are a few situations affecting Protein...
5. Both epigenetic and genetics can affect gene expression. Below are a few situations affecting Protein X. Please describe for each situation if: A) protein X will be more or less transcribed (or no change), AND B) if this is due to genetic or epigenetic changes. A. Mutation in Protein D so it can no longer target Protein X for deacetylation B. Mutation of the consensus sequence in the promoter of Protein X, resulting in increased association with RNA polymerase...
A coworker supplies you with a PCR product of a gene that encodes a protein your...
A coworker supplies you with a PCR product of a gene that encodes a protein your company wants to overproduce. You are told the DNA has ONLY the coding sequence of the gene. You must be sure the plasmid you choose to ligate this fragment into has an appropriately placed Question 5 options: A) Antibiotic resistance gene B) Promoter C) Ribosome binding site D) B and C E) All of the above
If a gene segregates randomly with the dominant mutations located on chromosome 2 (Cy/Pm) but not...
If a gene segregates randomly with the dominant mutations located on chromosome 2 (Cy/Pm) but not with those on chromosome 3 (D/Sb), it is located on: Chromosome 1 (the X) Chromosome 2 Chromosome 3 Chromosome 4
Gene expression is complex, requiring many macromolecules and events. This means....lots of vocabulary terms!!! Complete this...
Gene expression is complex, requiring many macromolecules and events. This means....lots of vocabulary terms!!! Complete this matching to show me your mastery of the language. You may want to read the introduction to Lab 15: Gene Expression. molecule that serves as a template for mRNA synthesis name of the process my which RNA is made name of the enzyme that makes RNA direction of RNA synthesis where transcription occurs in prokaryots where transcription happens in eukaryots where RNA polymerase binds...
For the following amino acid strand (shown from N to C-terminus) Asp-Pro-Cys-Gly-Ser-Try A.) Draw the structure...
For the following amino acid strand (shown from N to C-terminus) Asp-Pro-Cys-Gly-Ser-Try A.) Draw the structure of the hexapeptide w/ appropriate stereochemistry.    B.) What forces hold the above peptide in an α-helix? What part of the peptide is involved? C.) This hexapeptide is one of three peptide chains in a protein. What forces hold the above peptide in its 4o structure?
The position of a gene located within a light G band on the long arm of...
The position of a gene located within a light G band on the long arm of chromosome 5 could be at which specific position? a)5p13-pter. b)513-qter. c)5q13-qter. d)p513. e)q513.
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes the 3' untranslated sequence and the first part of the translated sequence. The promoter for this gene is TATAT. Transcription begins with the third base after the promoter. For each answer portion, in your response, write each one starting on a new line and please write A, B, C, etc. as you go. A)   Transcribe and B). translate this sequence into its final peptide...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT