Question

How to co-relate DNA sequence to protein sequence? How to co-relate DNA sequence to protein sequence...

How to co-relate DNA sequence to protein sequence?

How to co-relate DNA sequence to protein sequence of PTC receptor (or TAS2R38 gene)?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Ans 1: Well, it's a lengthy answer, and someone can choose any of the correct answers but I will specify one of them. The DNA sequence is made up of nucleotides while proteins are amino acids. If you want to see which DNA sequence will exactly give rise to the correct amino acid then use bioinformatic tools such as MEGA-X. Difficulties are seen when you get a stop codon at the first step of the DNA sequence but it is removed by the various tools. A three-letter code called "codon" is found in the DNA sequence that will ultimately give rise to a specific amino acid during the translation process.

Ans 2: PTC receptor protein is made up of ~333 amino acids in humans. You can correlate this sequence from the FASTA sequence of the gene from the following pathway ncbi>gene>FASTA sequence.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Describe in detail what happens in a gustatory cell when PTC binds the G-protein coupled receptor...
Describe in detail what happens in a gustatory cell when PTC binds the G-protein coupled receptor TAS2R38.
During transcription, the sequence of nucleotides in a gene in the DNA determines the sequence of...
During transcription, the sequence of nucleotides in a gene in the DNA determines the sequence of ________ in mRNA. Proteins are polymers of 20 different types of amino acids. During translation, the sequence of nucleotides in mRNA determines the sequence of _________ in the protein.
Mutations can be classi?ed by their effect on the DNA sequence OR the encoded protein. a....
Mutations can be classi?ed by their effect on the DNA sequence OR the encoded protein. a. How do mutations in the DNA alter protein structure? b. How do mutations in proteins alter their function? c. Why are some mutations less deleterious than others?
Given a DNA sequence, predict the effect of the resulting protein when there is a mutation...
Given a DNA sequence, predict the effect of the resulting protein when there is a mutation in that sequence.
What protein product is encoded for by the DNA sequence: (show all work)   TACCTAAAAACTACTACTACTAGTGTGGAGCCACACCCTAGTTGGCCAATCTATCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAATAC … Please,...
What protein product is encoded for by the DNA sequence: (show all work)   TACCTAAAAACTACTACTACTAGTGTGGAGCCACACCCTAGTTGGCCAATCTATCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAATAC … Please, show me the steps on how to read sequence.
Utilizing recombinant DNA technology methods, a DNA sequence coding for the KDEL peptide region characteristic of...
Utilizing recombinant DNA technology methods, a DNA sequence coding for the KDEL peptide region characteristic of ER resident proteins was engineered into a gene for a protein that is destined to be secreted out of a cell (eg., Insulin protein that is secreted by pancreatic acinar cells). The hybrid secretory protein coding gene bearing the KDEL coding sequence was introduced into cultured pancreatic cells. You would expect: a.       the hybrid secretory protein would be secreted out of the cell and...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
Explain the importance of sequence-specific DNA and RNA-binding proteins in the regulation of gene expression, with...
Explain the importance of sequence-specific DNA and RNA-binding proteins in the regulation of gene expression, with reference to a member of each class of regulatory protein.
1. You have cloned the gene sequence of the novel eukaryotic protein you have named Protein...
1. You have cloned the gene sequence of the novel eukaryotic protein you have named Protein Bob (2,100 bpin length). You have used PCR to amplify up the Protein Bob gene from your isolated genomic DNA. After growing up colonies and testing the plasmid you discovered that your cloning protocol has gone according to plan and you did every step correctly, there was no human error. Yet, there is no functional protein production. Explain the reasoning behind this problem. How...
Provide the correct mRNA sequence for the following DNA sequence, and then translate this into the...
Provide the correct mRNA sequence for the following DNA sequence, and then translate this into the proper amino acid sequence for the protein the gene would encode: 5′ ATG GAA CGC CTT TAC ATC GTG TGG CAT TAT AGC CAA CGC GTT TAA 3′ Coding 3′ TAC CTT GCG GAA ATG TAG CAC ACC GTA ATA TCG GTT GCG CAA ATT 5′
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT