Question

Explain how gene expression is regulated by changes made to chromatin and DNA.

Explain how gene expression is regulated by changes made to chromatin and DNA.

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

DNA is packed with proteins which are called histone and DNA-histone complex is known as chromatin. When chromatin remains in condensed form, DNA becomes less available to the enzymes of trancription and gene expressionl Whereas, several regulators perform modifications in chromatin structure like histone acetalytion, methylation causes chnages in the chromatin structure. When chromatin structure becomes loosens it allows transcripton factors to access the DNA inside and increase the gene expresson,

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
How is gene expression controlled at the level of the gene or DNA (chromatin level) itself?...
How is gene expression controlled at the level of the gene or DNA (chromatin level) itself? Give two examples.
which part of gene expression can be regulated by non-coding RNA (A) chromatin remodeling (B) mRNA...
which part of gene expression can be regulated by non-coding RNA (A) chromatin remodeling (B) mRNA degradation, translation and chromatin remodeling (C) mRNA degradation (D) translation (E) mRNA degradation and translation
What is a gene knockout (KO)? Indicate whether the gene expression is regulated at transcriptional and/or...
What is a gene knockout (KO)? Indicate whether the gene expression is regulated at transcriptional and/or translational level. Briefly explain your answer.
Changes to histone proteins such as acetylation can affect gene expression because: a. acetylated histones bind...
Changes to histone proteins such as acetylation can affect gene expression because: a. acetylated histones bind to specific DNA sequences near promoters to activate transcription b. chromatin with acetylated histones is decondensed and more accessible to transcription factors c. acetylated histones bind to specific DNA sequences near promoters to repress transcription d. RNA polymerase cannot transcribe past nucleosomes with acetylated histones. Please explain why the other answer choices are incorrect, thank you in advance!
Which of the following statements about the regulation of gene expression in eukaryotes is correct? A....
Which of the following statements about the regulation of gene expression in eukaryotes is correct? A. Gene activity cannot be regulated by the packaging of DNA. B. Gene activity can be regulated by initiation of transcription. C. Gene activity cannot be regulated by processing of the RNA transcript. D. Gene activity cannot be regulated by elongation of the RNA transcript. E. Gene activity cannot be regulated by termination of the RNA transcript.
Explain the importance of sequence-specific DNA and RNA-binding proteins in the regulation of gene expression, with...
Explain the importance of sequence-specific DNA and RNA-binding proteins in the regulation of gene expression, with reference to a member of each class of regulatory protein.
List the possible levels of gene expression control in the typical embryo, i.e., from the DNA...
List the possible levels of gene expression control in the typical embryo, i.e., from the DNA itself to the final functional protein product. Explain, briefly, how each step could be a control point for gene expression. BE AS DETAILED AS POSSIBLE
what are the effects of a dna mutation on gene expression
what are the effects of a dna mutation on gene expression
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).
Vector unpacking is generally assumed to be necessary for DNA release and gene expression, but the...
Vector unpacking is generally assumed to be necessary for DNA release and gene expression, but the extent to which dissociation affects gene delivery is unclear. detail . what is "Vector unpacking "??????
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT