Question

11. The DNA extracted from a bacteriophage consists of 24 percent A, 30 percent T, 20...

11. The DNA extracted from a bacteriophage consists of 24 percent A, 30 percent T, 20 percent G and 26 percent C. what is unusual about this DNA? What can you conclude about its structure?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Answer 11.
This DNA does not seem to follow Chargaff's Rule which states that state that DNA from any cell of any organisms should have a 1:1 ratio of pyrimidine and purine bases and, more specifically, that the amount of guanine should be equal to cytosine and the amount of adenine should be equal to thymine.
What we could conclude about its structure is that it is most likely to be an ssDNA-based virus since that way there is no reason for base complementarity to obey Chargaff's rule. This phenomena has been observed before and is termed "Szybalski's rule".

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Fill in the complementary DNA strand: A T G G C T G A T T...
Fill in the complementary DNA strand: A T G G C T G A T T G A ___________________________________ Which enzyme is involved with adding new deoxynucleotides during DNA replication? ___________________________ Who were the three scientists who got the credit for discovering that DNA was a double helix and the exact structure? _______________________ _______________________ _______________________ During transcription ____________ is made. During translation _____________ is made. The energy source for DNA replication is ________ and for transcription is ____________ The energy...
Assume that the molar percentage of thymine in a double stranded DNA is 20. What are...
Assume that the molar percentage of thymine in a double stranded DNA is 20. What are the percentages of the four bases (G, C, T, A)? b. The base content of a sample of DNA is as follows: A=31% G=31% T=19% C=19%. What conclusion can be drawn from this information?
Consider the following allele frequencies for three SNPs SNP1 SNP2 SNP3 Africa A:20%,T:80% G:70%,T:30% C:20%,A:80% Asia...
Consider the following allele frequencies for three SNPs SNP1 SNP2 SNP3 Africa A:20%,T:80% G:70%,T:30% C:20%,A:80% Asia A:50%,T:50% G:20%,T:80% C:20%,A:80% South America A:60%,T:40% G:80%,T:20% C:70%,A:30% Where is this person from? 1) SNP1:A,T 2) SNP2:T,T 3) SNP3: A,A Can someone please help me? Explaining all the steps. I don't know what to do. Thank you!
Messelson and Stahl, determined that when DNA replication is completed, a)each new DNA double helix consists...
Messelson and Stahl, determined that when DNA replication is completed, a)each new DNA double helix consists of one old DNA strand and one new DNA strand b)each of the four DNA strands consists of some old strand parts and some new strand part one DNA double helix consists of two old strands and one DNA double helix consists of two new strands The Meselson-Stahl experiment was designed to answer which question? How does DNA replicate? What does the secondary structure...
DNA can be distinguished from its “cousin” RNA because A. DNA is always single stranded B....
DNA can be distinguished from its “cousin” RNA because A. DNA is always single stranded B. DNA is always double stranded C. DNA is comprised of a base, a ribose sugar ring attached to a phosphate group D. RNA has an hydroxyl group on the 3’ carbon of its ribose ring structure E. DNA has an hydroxyl group on the 2’ carbon of its ribose ring structure F. RNA has an hydroxyl group on the 2’ carbon of its ribose...
Consider the following allele frequencies for three SNPs SNP1 SNP2 SNP3 Africa A:20%,T:80% G:70%,T:30% C:20%,A:80% Asia...
Consider the following allele frequencies for three SNPs SNP1 SNP2 SNP3 Africa A:20%,T:80% G:70%,T:30% C:20%,A:80% Asia A:50%,T:50% G:20%,T:80% C:20%,A:80% South America A:60%,T:40% G:80%,T:20% C:70%,A:30% For each genotype, calculate the genotype frequency in Africa and Asia. Can someone please help me? Showing all the steps. I don't know what to do. Thank you!
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT...
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT What would be the effect on the sequences of the mRNA & tRNA & the final protein’s sequence? mRNA: transcribe mRNA using the following from the DNA string: T=A, A=U, G & C pair tRNA: transcribe tRNA using the following from the mRNA string: A & U pair, G & C pair Protein: using the Condon chart and the mRNA strand. What I do...
A program was timed for 8 different input sizes (T(10)=67.87, T(20)=171.16, T(30)=289.10, T(40)=416.55, T(50)=551.08, T(60)=691.25, T(70)=836.10,...
A program was timed for 8 different input sizes (T(10)=67.87, T(20)=171.16, T(30)=289.10, T(40)=416.55, T(50)=551.08, T(60)=691.25, T(70)=836.10, T(80)=984.97). From the data in the table what can you hypothesize about the growth rate of the running time (Big O) of the program? Show how you obtained your conclusion.
For the purposes of this problem we will ignore the fact that viral genomes can also...
For the purposes of this problem we will ignore the fact that viral genomes can also be segmented or nonsegmented.You will need to do some outside research and examine the functional differences between two types of enzymes: exonucleases and endonucleases. Suppose four viral genomes were examined in the laboratory. The following information was obtained for each viral genome: Genome of virus 1: A = 28%, C= 22%, G = 24%, T = 0%, U = 26%, resistant to exonucleases but...
Electrophoresis Virtual Lab (11 Pts) 1. DNA will move toward which color electrode? What electrical charge...
Electrophoresis Virtual Lab (11 Pts) 1. DNA will move toward which color electrode? What electrical charge does this pole have? What about the structure of DNA, specifically, is responsible for this behavior? (3) 3. What is the purpose of a DNA standard in your gel? (2) 5. Let’s analyze the following scenarios: A. gels were prepared and the DNA samples, along with a DNA standard were placed in the wells. After an hour running the gel, the samples seem to...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT