Question

1. Sickle Cell Anemia is a genetic disease caused by abnormally shaped hemoglobin in the red blood cells. The defect is in the beta-hemoglobin gene, and the mutation is well known. In your genetic engineering lab, you plan to clone the normal sequence of the beta-hemoglobin gene into a plasmid, and then to transfer this plasmid into bacterial cells in order to make enough normal protein to pump into the blood of patients with sickle cell anemia. A partial sequence of the actual coding region for the beta-hemoglobin gene is shown below in gray and underlined. You will cut this gene out with a restriction enzyme and transfer it into a new plasmid, pBYUI (the plasmid map is shown below), to turn it into a commercial cloning plasmid. A table containing different restriction enzymes and their corresponding recognition sequences is provided below. Your task is to figure out which enzyme, or enzymes, you would use to cut the beta-hemoglobin gene out in order to facilitate cloning it into pBYUI (similar to what we did in class with the paper cloning). Hints: • Start by finding all the possible restriction sites in the sequence below. • Identify sites that will allow the entire gray sequence to be transferred. (In other words, identify sites that flank the gray, underlined sequence.) You do NOT want to pick an enzyme that cuts within the gray highlighted region • Identify sites that are compatible with the pBYUI plasmid. Remember in order to ligate properly we need to have the same overhangs (compatible ends). That only occurs if you can cut both the insert (beta-hemoglobin gene) and plasmid (pBYUI) with the same enzyme(s). Beta-hemoglobin gene (gray highlighted and underlined). Circle all the restriction sites in the entire sequence (not just underlined region) below and write the name of the enzyme above each circle. 5’-CTGCAGTCACCATGGCGACGGCCCGGGCGTTGAGATTCCATGCTCGTAAGACCTA CCATGCCGCCAATGTTGTTCCATGGACCGACCAGACCGATCTCTTCTACACCATGAAA GGGATCCCTGAAGAACAGCAAGTCTGACCCGGGCTGCAGCAAAAATGAGGATCCA-3’

Answer 1

Restriction enzymes resulting in sticky ends (overhangs) have been provided

Various enzymes have been indicated by numbers from 1 and 7 above their encircled restriction sequence in the gene

The details of the restriction enzymes are tabulated below

Enzyme number in sequence	Name	Cutting sequence	Cutting site
1	Tsp45I	GTCAC	Cuts before G of GTCAC (From 5’)
2	NcoI	CCATGG	Cuts between C and C (From 5’)
3	Hpy99I	CGACG	Cuts after second CG (From 3’)
4	TfiI	GATTC	Cuts between G and A (From 5’)
5	TauI	GCCGC	Cuts between second GC (From 3’)
6	AvaII	GGACC	Cuts between G and G (From 5’)
7	BamHI	GGATCC	Cuts between G and G (From 5’)