Question

List the modifications to RNA that make it an mRNA in eukaryotes. What are these for?...

List the modifications to RNA that make it an mRNA in eukaryotes. What are these for?
Who does these?

Homework Answers

Answer #1

5? Capping
7-methylguanosine cap is added to the 5? end of pre mRNA.
It protects the nascent mRNA from degradation.

3? Poly-A Tail
Poly-A polymerase adds a approximately 200 A residues, called the poly-A tail.
It protects the pre-mRNA from degradation and signals the export of the cellular factors that the transcript needs to the cytoplasm.

Pre-mRNA Splicing
Introns are removed and degraded while the pre-mRNA is still in the nucleus.
The splicing of pre-mRNAs is conducted by complexes of proteins and RNA molecules called spliceosomes.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
What must be cut out of mRNA in eukaryotes before translation can occur? What are two...
What must be cut out of mRNA in eukaryotes before translation can occur? What are two modifications that eukaryotes make to mRNA that prokaryotes do not?
Eukaryotes have three different types of RNA pol. What are these three types, where are they...
Eukaryotes have three different types of RNA pol. What are these three types, where are they active. What type of RNA do they make?
Eukaryotes like to modify their mRNA after / during transcription. What do they do to it...
Eukaryotes like to modify their mRNA after / during transcription. What do they do to it and why?
1. Why can't transcription and translation of an mRNA occur at the same time in eukaryotes...
1. Why can't transcription and translation of an mRNA occur at the same time in eukaryotes like it does in prokaryotes? In bacteria, translation of an mRNA can begin before its transcription is complete. mRNA synthesis begins at the 5' end and moves toward the 3' end.  After the 5' end is made, ribosomes can bind and begin translation. This coupling of transcription and translation does not occur in eukaryotes. Why not? 2. There is an amino acid that transfers its...
30. Which TWO modifications of heterogenous nuclear RNA is important for the stability of the transcription...
30. Which TWO modifications of heterogenous nuclear RNA is important for the stability of the transcription and for its translation? 31. Below is a sequence of a heterogenous nuclear RNA with exons shaded grey and nucleotides that are important for splicing indicated in bold. ...cacccggctcccgcttcacctggggcacagtgcaggtggtcacaggccaagcgggcacgcccactgtgccccccgaccccagcccacagg    ctcctgtccctgcccactcagcttcaaggcct… Which cis-acting elements come into close proximity to form the lariat during splicing? Extra credit: What is the protein that is translated from the mRNA indicated in questions 25 and 26 and what is...
What are the functions of DNA and RNA (including mRNA, tRNA, rRNA)?
What are the functions of DNA and RNA (including mRNA, tRNA, rRNA)?
How is mRNA of the nematode silenced in RNA interference?
How is mRNA of the nematode silenced in RNA interference?
Most of the mRNA in eukaryotes are Question 62 options: monocistronic polycistronic multicistronic operons
Most of the mRNA in eukaryotes are Question 62 options: monocistronic polycistronic multicistronic operons
mRNA translation can be regulated in eukaryotes to either increase or decrease the translation of a...
mRNA translation can be regulated in eukaryotes to either increase or decrease the translation of a mRNA. Two proteins eIF2 and eIF4B are central in this process. Detail how these proteins are regulated (mechanisms) and what is the outcome of this regulation (i.e. state regulatory condition and if that state either increases or decreases overall translation of mRNAs in the cell).
Name 3 post transcriptional modifications of eukaryotic mRNA and briefly explain the purpose of each
Name 3 post transcriptional modifications of eukaryotic mRNA and briefly explain the purpose of each
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT